SciELO - Scientific Electronic Library Online

 
vol.65 número3Urticaria crónica con alteraciones de la función tiroidea y anticuerpos antiperoxidasa tiroideaLepidopterismo por Hylesia Nigricans (mariposa negra): Investigación y acción preventiva en Buenos Aires índice de autoresíndice de materiabúsqueda de artículos
Home Pagelista alfabética de revistas  

Servicios Personalizados

Articulo

Indicadores

  • No hay articulos citadosCitado por SciELO

Links relacionados

  • En proceso de indezaciónCitado por Google
  • No hay articulos similaresSimilares en SciELO
  • En proceso de indezaciónSimilares en Google

Bookmark


Medicina (Buenos Aires)

versión On-line ISSN 1669-9106

Medicina (B. Aires) v.65 n.3 Buenos Aires mayo/jun. 2005

 

Genotipificación del gen HLA DQB1 en diabetes autoinmune del adulto (lada)

Mariela Caputo1, Gloria E. Cerrone1, Ariel P. López1, 2, Claudio Gónzalez3, Carmen Mazza4, Norberto Cedola5, Félix M. Puchulu6, Héctor M. Targovnik1, Gustavo D. Frechtel1, 2

1Cátedra de Genética y Biología Molecular, Facultad de Farmacia y Bioquímica, Universidad de Buenos Aires; 2División Genética, Hospital de Clínicas José de San Martín, Universidad de Buenos Aires;  3Cátedra de Farmacología, Facultad de Medicina, Universidad de Buenos Aires; 4Unidad de Nutrición, Hospital de Pediatría Juan P. Garrahan, Buenos Aires; 5Centro de Endocrinología Experimental y Aplicada, Universidad Nacional de La Plata - CONICET; 6División Diabetología, Hospital de Clínicas José de San Martín, Facultad de Medicina, Universidad de Buenos Aires

Dirección postal: Bioq. Mariela Caputo, Cátedra de Genética y Biología Molecular, Facultad de Farmacia y Bioquímica, Av. Córdoba, 2351, 1120 Buenos Aires., Argentina. Tel/Fax: 4964-8296, e-mail: mcaputo@ffyb.uba.ar

Resumen
La diabetes  autoinmune es una enfermedad  multifactorial causada por factores genéticos predisponentes y ambientales desencadenantes. Se manifiesta en la edad infantojuvenil (diabetes tipo 1, DMID) y en la edad adulta (diabetes autoinmune latente del adulto, LADA). La predisposición genética es de tipo poligénico, se ha establecido asociación con alelos polimórficos del gen DQB del sistema HLA, VNTR del gen de insulina y polimorfismos en el gen CTLA4. En el presente trabajo se analizaron las frecuencias de los alelos polimórficos del gen HLA DQB1 en 63 pacientes LADA, 70 pacientes DMID y 79 individuos normales. La tipificación de los alelos del gen DQB1 se llevó a cabo mediante el Kit SSPTM DQ Olerup. Se observó una mayor frecuencia del genotipo *0201-*0302 y *0201-*0201 en ambas poblaciones diabéticas con respecto a normales (p<0.05). La presencia del genotipo *0201-*0302 fue mayor en DMID que en LADA (p<0.05). Por otra parte, el análisis del alelo protector *0602 muestra una alta prevalencia en individuos normales con respecto a la población diabética. El alelo de susceptibilidad más frecuente en pacientes LADA y DMID de nuestro país fue el *0201. En conclusión, LADA presenta susceptibilidad genética dada por alelos del gen HLA DQB1 pero en forma menos determinante que en diabetes tipo 1. A su vez, el hallazgo del aumento en la frecuencia del alelo *0201, tanto en frecuencias alélicas como genotípicas permite caracterizar nuestra población de pacientes tanto LADA como DMID a diferencia de otras poblaciones en las que el alelo más frecuente es el *0302.

Palabras clave: LADA, HLA, GADA, Diabetes autoinmune, Genética

Abstract
HLA DQB1 genotyping in latent autoimmune diabetes of adults (LADA). Autoimmune diabetes is a complex, multifactorial disease caused by the interaction of genetic and environmental factors. This autoimmune diabetes is commonly manifested in childhood and adolescence with a fast onset  (type 1 diabetes, IDDM) and it can occur in adult patients with a slow onset with delayed insulin requirement, (latent autoimmune diabetes in adults, LADA ). Autoimmune diabetes has strong class II HLA association mainly with DQB gene which constitutes the first susceptibility locus. However, association with the 5’INS- VNTR and CTLA-4 genes has been established. In this study, we analysed the polimorphic allele frequencies of DQB HLA gene in 63 LADA patients, 70 IDDM and 79 control subjects. The HLA DQB1 alleles typing was detected through Olerup SSPTM DQ kit using sequence specific primers. We observed a positive association of *0201-*0302 and *0201-*0201 genotypes in both types of diabetic patients compared to the control group (p<0.05). Moreover, *0201-*0302 genotype was higher in IDDM than in LADA (p<0.05). On the other hand, the *0602 protective allele analysis showed a high prevalence in the normal group compared to the diabetic population. In Argentina, the most frequent allele of susceptibility in LADA and IDDM patients was the *0201. Summing up, the finding of an increase in the *0201 allele, both in allelic and genotypic frequencies, allows the characterisation of our population of patients, LADA and IDDM, unlike other populations, in which the most frequent allele is *0302.

Key words: LADA, HLA, GADA, Autoimmune diabetes, Genetics

      La diabetes autoinmune es una enfermedad multifac-torial causada por interacción de factores genéticos de predisposición y ambientales desencadenantes. Se manifiesta de manera abrupta en la niñez y adolescencia (diabetes tipo 1 o diabetes mellitus insulinodependiente, DMID), siendo sus principales síntomas la cetoacidosis diabética y la insulinodeficiencia1.
      Sin embargo, puede presentarse en individuos adultos con lento desarrollo de la enfermedad hasta la instauración de la terapia insulínica a largo plazo. Esta forma de presentación  se caracteriza por la aparición de signos clínicos compatibles con diabetes tipo 2 (diabetes mellitus no insulino dependiente, NDMID) y por la presencia de autoanticuerpos dirigidos principalmente contra la enzima ácido glutámico descarboxilasa (GADA)2. Este anticuerpo junto con la presencia de autoanticuerpos contra la proteína fosfatasa de células del islote (ICA 512) y contra la propia molécula de insulina (IAA) son los marcadores que mejor predicen el requerimiento insulínico3.
     
Las características de estos pacientes son las siguientes: edad mayor de 35 años, peso normal o disminuido, secreción de insulina medida por dosaje de péptido C normal o disminuida y control metabólico mantenido con dieta o hipoglucemiantes orales durante al menos los primeros 6 meses del inicio de la diabetes4.
     
Este tipo de diabetes representa alredededor del 10% de los pacientes previamente diagnosticados como diabéticos tipo 2, y puede ser interpretada como una manifestación tardía de diabetes tipo 1 o un subtipo independiente con entidad clínica propia5, 6.
     
Inicialmente fue denominada diabetes tipo 1,5 pero acorde con la clasificación de la OMS, esta entidad es lla-mada diabetes latente autoinmune del adulto o LADA7,  8.
     
El proceso autoinmune dirigido contra la célula b del páncreas es más lento y progresivo, lo cual hace difícil la distinción clínica entre este tipo de pacientes y los diabéticos tipo 2: los síntomas clínicos son insidiosos, con ausencia de signos patognomónicos de diabetes tipo 1 como poliuria, polidipsia, pérdida de peso o cetoacidosis. A su vez, es difícil de demostrar la insulinopenia en sujetos diabéticos adultos con autoinmunidad, sobre todo al comienzo de la enfermedad9.
     
Al comparar los signos clínicos con pacientes diabéticos tipo 1, el individuo con LADA es de mayor edad, posee un mayor índice de masa corporal (IMC), mayores niveles de péptido C y una mayor historia familiar de diabetes tipo 210. En cambio, comparado con el paciente diabético tipo 2, el individuo con LADA es más joven, posee un menor IMC y tiene niveles menores de péptido C al momento del diagnóstico11.
     
La presencia de autoanticuerpos contra la célula b y la determinación de ciertos alelos de susceptibilidad  DR y DQ del sistema HLA asociados a diabetes tipo 1 incluyen a la diabetes tipo LADA dentro de las enfermedades autoinmunes12.
     
La presencia del aminoácido Asp en el residuo 57 del receptor antigénico de clase II producto de la expresión del gen DQB1 ejerce un rol protector, mientras que la ausencia del mismo indica susceptibilidad para diabetes autoinmune13.
     
La predisposición genética a diabetes LADA no ha sido fehacientemente establecida, aunque se ha demostrado asociación con alelos polimórficos del gen DQB del Sistema HLA, el cual contribuye con el 50% de la susceptibilidad genética para diabetes infantojuvenil.
     
Sin embargo, factores genéticos en otros locus secundarios como el minisatélite en el extremo 5’ del gen de la insulina en el cromosoma 11 (5’ INS-VNTR) y el CTLA-4 en el cromosoma 2 contribuyen al riesgo de la diabetes autoinmune14.
     
El minisatélite ubicado a 5’ del gen de la insulina está constituido por un VNTR (número variable de repeticiones en tandem) con variantes alélicas clasificadas en tres tipos de alelos según el número de repeticiones: clase I (20-44), clase II (45-110) y clase III (>110). Estos polimorfismos están relacionados a diabetes tipo 1, los alelos de clase I están asociados a susceptibilidad, mientras que los de clase III a protección. A su vez, el alelo de clase I se subdivide en 1S (23 a 37 unidades de repetición - UR), 1M (38 a 41 UR) y 1L (42 a 44 UR) siendo los alelos de clase 1S de mayor prevalencia en diabetes tipo 1 y LADA15, 17.
     
Con respecto al gen CTLA-4, se ha observado una alta prevalencia del genotipo heterocigota para el polimorfismo de nucleótido único A49G en pacientes LADA16. Estos individuos presentan un nivel mayor de ARN mensajero de la forma soluble del CTLA-4 del alelo protector (A49) que del alelo predisponente (G49), dando lugar a una mayor regulación negativa de los linfocitos autorreactivos, y por consiguiente una mayor protección de la célula beta18.
     
Por lo tanto, dado que el Sistema HLA de clase II contribuye mayoritariamente a la predisposición genética a diabetes tipo 1, en el presente trabajo se analizaron las frecuencias de los alelos polimórficos del HLA DQB1 en una población de pacientes LADA argentinos comparado con pacientes diabéticos tipo 1 y un grupo control.

Materiales y métodos

A partir de 160 pacientes previamente caracterizados por rasgos clínicos como LADA (inicio con más de 35 años, con una edad de 51.4 ± 2.6 años, necesidad de terapia insulínica en un período menor a 6 años desde el diagnóstico), se seleccionaron 63 pacientes que presentaban al menos uno de los siguientes anticuerpos: GADA, IAA o ICA 512.
      También fueron estudiados 70 pacientes DMID con auto-inmunidad positiva comprobada. La edad media del inicio fue de 15 ± 9.2 años y la terapia insulínica fue instalada dentro de los 6 meses posteriores al diagnóstico. Tanto los pacientes DMID como los LADA fueron diagnosticados de acuerdo al criterio de la Organización Mundial de la Salud (OMS)19.
      Se tomó como población control 79 individuos no relacionados, con glucemia normal en ayunas, sin historia familiar de diabetes y con IMC < 27 kg/m2.
      Todos los individuos estudiados fueron informados de los objetivos del estudio brindando su consentimiento para la realización de los mismos.
      A partir de leucocitos de sangre periférica se purificó ADN genómico y se procedió a la tipificación de los alelos poli-mórficos correspondientes al gen DQB1 mediante el Kit Olerup SSPTM DQ, el cual utiliza primers aleloespecíficos del exón 2. La genotificación fue determinada acorde a las instrucciones de manufacturación: los productos se sometieron a electroforesis en gel de agarosa al 2% teñido con bromuro de etidio y detectados con transiluminador UV.
      Los resultados obtenidos fueron interpretados en base a tablas específicas. La discriminación de los siguientes alelos se determinó mediante digestión enzimática: *0602 y 0603, Tsp 45AI; *0302, Sau 96I y Hha I.
      La determinación del aminoácido Asp en la posición 57 de la molécula de HLA DQB1 se realizó a través de la técnica PCR-ARFLP amplificando la zona de interés con los siguientes  primers: DB130 5’ AGGGATCCCCGCAGAGG ATTTCGT-GTACC3’, PR1 5’ TTCCTTCTGGCTGTTCCAGTACTCGGAG 3’, PR2 TTCCTTCTGGCTGTTCCAGTACTCGGAA 3’20. Se utilizaron 50 pmol de cada primer, 1.5 mM de Cl2Mg, 200 µM de dNTP’s, 500 ng de ADN y 2 U de polimerasa Taq (T-plus DNA polimerase Inbio-Highway). El ciclado consistió en una desnaturalización inicial a 94 °C durante 2 minutos y 30 ciclos compuestos por desnaturalización a 94 °C 1 minuto, annealing a 55 °C 1 minuto, elongación a 72 °C 1 minuto, siendo la extensión final de 6 minutos a 72 °C. La presencia de los codones que codifican para el aminoácido Asp genera un sitio de corte para la enzima Hinf I. Para la identificación de tales codones se digirieron 5 µl del producto de PCR con 50 unidades de la enzima Hinf I (Biolabs) en un volumen final de 100 µl. La digestión fue sometida a electroforesis en gel de poliacrilamida al 8% con posterior tinción argéntica.
      Las frecuencias se compararon mediante tablas de contingencia aplicando el test de c2 utilizando el software Graph Pad Instat. p <0.05 fueron consideradas estadísticamente significativas. Los riesgos relativos se calcularon como Odds Ratio (OR) mediante la aproximación de Woolf.

Resultados

Los resultados muestran una mayor prevalencia estadísti-camente significativa del genotipo Asp -/- en los pacientes LADA (47.6%), con respecto a los individuos normales (22.8%). Al comparar las frecuencias genotípicas entre los pacientes DMID y LADA se observó una mayor frecuencia del genotipo Asp -/- en los primeros (78.6 % vs 47.6%) (Tabla 1).

TABLA 1.– Frecuencias genotípicas para el aminoácido Asp en la posición 57 en las distintas poblaciones estudiadas

      Al analizar el genotipo protectivo Asp +/+, se observa una mayor frecuencia estadísticamente significativa en los individuos normales con respecto a ambos grupos de pacientes diabéticos (Tabla 1).
     
Por otra parte, no hemos hallado diferencias significativas en el genotipo Asp -/+ entre pacientes LADA e individuos controles, hecho que sí ocurre al comparar pacientes DMID e individuos normales.
     
Asimismo, al analizar ambos grupos de pacientes diabéticos, se observan diferencias altamente significativas entre los distintos genotipos (c2=15.9; P=0.0003) hecho que confirma la dispersión genotípica entre ambos.
     
Cabe destacar que los ORs observados para el genotipo predisponente Asp -/-, son altos para los pacientes DMID y bajos para LADA. Esto comprueba la alta influencia que ejerce el gen HLA DQB1 en la genética de la diabetes tipo 1. De todas formas, se observa predisposición genética establecida por el HLA-DQB1 a diabetes autoinmune del adulto, presentando la población LADA una frecuencia intermedia entre la población normal y los pacientes DMID.
     
El análisis de los alelos de susceptibilidad en particular, demuestra una mayor presencia del genotipo *0201-*0302, predisponente para DMID, en el grupo LADA comparada con los individuos normales. Se observó que en pacientes DMID la frecuencia alcanza el 38.6%, a diferencia de los LADA cuya frecuencia fue de 17.5% (P=0.0071). Ambas poblaciones difieren con significación estadística del grupo control en el cual la frecuencia fue del 2.5% (Tabla 2).

TABLA 2.– Frecuencias de los distintos genotipos del gen HLA DQB1 para las diferentes poblaciones analizadas

      Por otra parte, la frecuencia del genotipo *0201-*0302 en diabéticos tipo 2 con clínica compatible con LADA y autoinmunidad negativa es del 7.7% (datos no mostrados).
     
También se observa una clara diferencia significativa en la presencia del genotipo *0201-*0201, tanto en la población de diabéticos LADA como en la de pacientes DMID con respecto a la población control, siendo las frecuencias de 6.3%, 8.6% y 0% respectivamente. (Tabla 2).
     
El análisis de las frecuencias alélicas para el alelo *0201 también demostró una alta prevalencia entre los pacientes diabéticos que difiere significamente de los individuos controles, (datos no mostrados) (p<0.0001).
     
Cabe destacar que la mayor prevalencia del alelo *0201 es un hallazgo que caracteriza a nuestra población y que la diferencia de otros trabajos publicados.
     
Por otra parte, no se han hallado diferencias signi-ficativas en la frecuencia del genotipo *0302-*0302 para ninguno de los grupos de pacientes diabéticos estu-diados con respecto a la población control, a diferencia de otros estudios realizados en población caucásica     (Tabla 2).
     
Por consiguiente, tanto el genotipo *0201-*0302 como *0201-*0201 presentan un OR consistente con susceptibilidad a la enfermedad, al igual que el genotipo *0201-Xa. Esto demuestra el aporte de estos alelos, aunque con frecuencias diferentes, a la predisposición genética a ambas formas de diabetes autoinmune: LADA y DMID.
     
Además, el análisis del alelo protector *0602 muestra una alta prevalencia en individuos normales con respecto a la población diabética (Tabla 2).
     
Se comprueba que los pacientes con DMID presentan la menor frecuencia para el alelo *0602 comparado con LADA e individuos normales. La prevalencia del mismo en pacientes LADA es más cercana a los DMID, demostrando así el grado de protección aportado por este alelo a ambas poblaciones, lo que se verifica estadísti-camente al comparar ambos grupos de pacientes diabéticos con la población control (Tabla 2).

Discusión

El análisis de la frecuencia del aminoácido Asp confirma los datos publicados, donde se observa una mayor incidencia del alelo de susceptibilidad (Asp -) en pacientes diabéticos tipo 113.
      El análisis en pacientes LADA demuestra una menor prevalencia de la forma homocigota Asp-/Asp- con respecto a los DMID, lo que coincide con Horton et al., quienes observaron un descenso progresivo del genotipo predisponente a medida que aumenta la edad de inicio de los pacientes con diabetes autoinmune21.
     
Los resultados obtenidos con respecto a los alelos específicos, concuerdan con otras poblaciones analizadas, en las cuales los polimorfismos de predisposición del gen HLA DQB1 demuestran una significativa asociación con LADA aunque en una menor prevalencia que en los diabéticos tipo 122.
     
La frecuencia del genotipo de mayor susceptibilidad, *0201-*0302, hallada en nuestra población de pacientes diabéticos tipo 1 (39%) es similar a lo hallado por Tuomi et al. en población caucásica (37%)22.
     
Lo mismo ocurre en los pacientes LADA donde se encontró una frecuencia del 17.5%, al igual que en otros estudios realizados en población caucásica: 13% y 12%23, 24.
     
Al comparar las frecuencias entre ambos grupos de pacientes diabéticos, se encontró una menor frecuencia del genotipo de mayor predisposición, *0201-*0302 en pacientes LADA comparado con diabéticos tipo 1, al igual que lo hallado por Tuomi et al.22.
      Por otra parte, si bien la frecuencia genotípica *0201-*0302 es alta en LADA, se verifica una mayor presencia de otros alelos polimórficos del gen DQB1 con efecto neutro (asignado como “otros” en la Tabla 2) en cuanto a susceptibilidad o protección a diabetes auto-inmune.
      En este primer estudio realizado en Argentina sobre la genética de predisposición a LADA, encontramos que la frecuencia de la forma heterocigota *0201-*0302 se presenta de manera intermedia entre los DMID y la población normal.
      La diferencia en la frecuencia de este genotipo en pacientes LADA (17.5%) y diabéticos tipo 2 con clínica compatible con LADA y autoinmunidad negativa (7.7%) no alcanza la significancia estadística. Sin embargo, las frecuencias obtenidas en nuestro estudio se corresponden a las halladas por Tuomi et al. (13% vs. 4%), las cuales han resultado estadísticamente diferentes (p<0.002)22.
      En contraste con lo hallado por Vatay et al., observamos un aumento significativo del alelo *0201 en la población LADA, al igual que pacientes diabéticos tipo 1, diferenciándose ambas de los individuos controles. Este hallazgo se correlaciona con estudios realizados en pacientes diabéticos tipo 1 caucásicos del sur de Europa donde encuentran una alta frecuencia del genotipo *0201-*020125.
      A diferencia de otros estudios, no se han observado diferencias estadísticamente significativas del alelo *0302 para ninguna de las dos poblaciones de individuos diabéticos comparado con la población control22, 23, 26, 27.
      Con respecto al alelo 0401, significativamente presente en pacientes LADA de origen japonés, no hemos verificado tal asociación en nuestro trabajo, hecho explicable por la diferencia étnica de ambas poblaciones28.
      Acorde con Hosszúfalusi et al., se ha visto una notable prevalencia del alelo protector *0602 en la población control comparada con los pacientes diabéticos tipo 1 y los pacientes LADA.
      El análisis de las frecuencias genotípicas para los alelos estudiados muestra la dispersión alélica de la población LADA y permite concluir que existe predisposición genética a la autoinmunidad, hecho que se ve reflejado en la aparición de distintos autoanticuerpos, predominando los dirigidos contra la proteína GAD 65.
      La diferencia en la prevalencia hallada del genotipo de mayor predisposición para diabetes tipo 1 podría estar relacionada con el retraso en la aparición de las manifestaciones clínicas que se comprueba en el tipo LADA.
      Asimismo, resulta evidente que al ser la diabetes autoinmune una enfermedad poligénica, la información que se obtiene de los marcadores HLA no es absoluta ni determinante, ya que existe un amplio número de individuos portadores de alelos de riesgo, que nunca llegan a desarrollar la enfermedad29. Por lo tanto, el estudio de otros locus polimórficos de susceptibilidad como el 5’INS-VNTR y el gen CTLA-4 entre otros, permitirá esclarecer el rol preciso de estos genes de susceptibilidad a diabetes autoinmune del adulto. Se ha observado que aun cuando la frecuencia de alelos de riesgo para el HLA es menor en pacientes LADA comparado con DMID, la frecuencia del genotipo de riesgo 1S/S correspondiente al 5’ INS-VNTR es mayor en LADA que en DMID17.
      En conclusión, LADA presenta susceptibilidad genética dada por alelos polimórficos del gen HLA DQB1 pero en forma menos determinante que en diabetes tipo 1. Es así como se observa un aumento en la prevalencia de alelos de susceptibilidad de otros locus de predisposición genética menor. Por lo tanto, la actividad del proceso patogénico y su manifestación fenotípica están determinadas por la interacción entre la dosis de alelos de riesgo conjuntamente con factores ambientales.
      A su vez, el hallazgo del aumento en la frecuencia del alelo *0201, tanto en frecuencias alélicas como genotípicas, permite caracterizar nuestra población de pacientes con diabetes autoinmune tanto LADA como DMID a diferencia de otras poblaciones en las que el alelo más frecuente es el *0302. De esta manera, reafirmamos nuestra relación con corrientes migratorias del sur de Europa.
      El análisis de la susceptibilidad genética, no sólo de genes HLA sino de otros marcadores genéticos, junto con el estudio de los marcadores de autoinmunidad, indudablemente contribuirá a la caracterización clínica y al diagnóstico precoz de diabetes LADA.
      De esta manera se podrá instituir un tratamiento adecuado desde el comienzo de la enfermedad así como también diseñar nuevas estrategias para prevenir diabetes de origen autoinmune tanto en la edad infanto-juvenil como en edad adulta.

Agradecimientos: Mariela Caputo es becaria del  Ministerio de Salud Pública (Becas Ramón Carrillo-Arturo Oñativia).
     
H.M. Targovnik es investigador del Consejo Nacional de Investigaciones Científicas y Tecnicas (CONICET).
     
Este trabajo fue realizado con los aportes de los siguientes subsidios: de Universidad de Buenos Aires (B 087/2001), CONICET (0853/98), FONCYT (05-08838/ PICT 2000/2001), apoyo financiero del Ministerio de Salud Pública (Becas Ramón Carrillo-Arturo Oñativia) y Fundación Barceló a G.D.F.

Bibliografía

1. Komulainen J, Kulmala P, Savola K, et al. Clinical, autoimmune, and genetic characteristics of very young children with type 1 diabetes: Childhood Diabetes in Finland (DiMe) Study Group. Diabetes Care 1999; 2: 1950-5.         [ Links ]
2. Bruno G, De Salvia A, Arcari R, et al. Clinical, inmmunological and genetic heterogeneity of diabetes in an Italian population-based cohort of lean newly diagnosed patients aged 30-54 years. Diabetes Care 1999; 22: 50-5.         [ Links ]
3. Lohman T, Kellner K, Verlohren HJ, et al. Titre and combination of IC and autoantibodies to glutamic acid decarboxylase discriminate two clinically distinct types of latent autoimmune diabetes in adults. (LADA). Diabetología 2001; 44: 1005-10.         [ Links ]
4. Landin-Olsson, M. Latent autoimmune diabetes in adults. Ann NY Acad Sci  2002; 258: 112-6.         [ Links ]
5. Sanjeevi CB, Gambelunghe G, Falorni A, et al. Genetics of latent autoimmune diabetes in adults. Ann NY Acad Sci  2002; 958: 107-11.         [ Links ]
6. Palmer JP, Hirsch IB. What’s in a name: latent autoimmune diabetes of adults, type 1.5, adult-onset, and type 1 diabetes. Diabetes Care 2003; 26: 536-8.         [ Links ]
7. Zimmet PZ, Tuomi T, Mackay IR, et al.Latent autoimmune diabetes mellitus in adults (LADA): the role of antibodies to glutamic acid decarboxylase in diagnosis and prediction of insulin dependency. Diabet Med 1994; 11: 299-303.         [ Links ]
8. Tuomi T, Groop LC, Zimmet PZ, Rowley MJ, Knowles W, Mackay IR. Antibodies to glutamic acid decarboxylase reveal latent autoimmune diabetes in adults with a non-insulin-dependent onset of disease. Diabetes 1993; 42: 359-62.         [ Links ]
9. Zimmet P, Turner R, McCarty D, Merril R, Mackay I. Crucial points at diagnosis. Diabetes Care 1999; 22: B59-B64.         [ Links ]
10. Martinka E, Strakova J, Galajda P, Shawkatova I, Buc M. Latent autoimmune (type1) diabetes mellitus in patiens classified as type-2: divergence of etiologic markers. Cas Lek Ces 2000; 139: 120-3.         [ Links ]
11. Kobayashi T, Tamemoto K, Nakanishi K, et al. Immuno-genetic and clinical characterization of slowly progressive IDDM. Diabetes Care 1993; 16: 780-8.         [ Links ]
12. Karjalainen J, Salmela P, Ilonen J, Surcel HM, Knip M. A comparison of chilhood and adult type I diabetes mellitus. N Engl J Med 1989; 320: 881-6.         [ Links ]
13. Forbes LV, Broewn LJ, Scott RS. HLA-DQB typing and non-Asp57 alleles ind IDDM and nondiabetic subjects in New Zealand. Diabetes Care 1993; 16: 1179-83.         [ Links ]
14. Abiru N, Kawasaki E, Eguch K. Current knowledge of Japanese type 1 diabetic syndrome. Diabetes Metab Res Rev 2002; 18: 357-66.         [ Links ]
15. Bennett ST, Lucassen AM, Gough SC, et al. Susceptibility to human type 1 diabetes at DMID2 is determined by tandem repeat variation at the insulin gene minisatellite locus. Nat Genet 1995; 9: 284-92.         [ Links ]
16. Cosentino A, Gambelunghe G, Tortoioli C, Falorni A. CTLA-4 gene polymorphism contributes to the genetic risk for latent autoimmune diabetes in adults. Ann NY Acad Sci  2002; 958: 337-40.         [ Links ]
17. Cerrone GE, Caputo M, López AP, et al.VNTR of the insulin gene determines susceptibility to LADA. Mol Diagn 2004; 8: 43-9.         [ Links ]
18. Anjos S, Polychronakos. Mechanisms of genetic susceptibility to type I diabetes: beyond HLA. Mol Genet Metab 2004; 81: 187-95.         [ Links ]
19. World Health Organization Study Group on Diabetes Mellitus Technical report series. World Health Organ Tech Rep Ser 1985; 727: 1-113.         [ Links ]
20. Patel P, Dennis-Lo YM, Bell JI, Wainscoat JS. Detection of susceptibility alleles to insulin-dependent diabetes mellitus at the DQB1 locus by artificial PCR-RFLP.  Immunogenetics 1992; 36: 264-5.         [ Links ]
21. Horton V, Stratton I, Bottazzo GF, et al. Genetic heterogeneity of autoimmune diabetes: age of presentation in adults is influenced by HLA DRB1 and DQB1 genotypes (UKPDS 43). UK Prospective Diabetes Study (UKPDS) Group. Diabetologia 1999; 42: 608-16.         [ Links ]
22. Tuomi T, Carlsson A, Li H, et al. Clinical and genetic characteristics of type 2 diabetes with and without GAD antibodies. Diabetes 1999; 48: 150-7.         [ Links ]
23. Vatay A, Rajczy K, Pozsonyi E, et al. Differences in the genetic background of latent autoimmune diabetes in adults (LADA) and type 1 diabetes mellitus. Immunol Letters 2002; 84: 109-15.         [ Links ]
24. Pozzilli P, Di Mario U. Autoimmune diabetes not requiring insulin at diagnosis (latent autoimmune diabetes of the adult). Diabetes Care 2001; 24: 1460-6.         [ Links ]
25. Ronningen KS, Keiding N, Green A. et al. Correlations between the incidence of childhood-onset Type I diabetes in Europe an HLA genotypes. Diabetologia 2001; 44: B51-B59.         [ Links ]
26. Hosszufalusi N, Vatay A, Rajczy K, et al. Similar genetic features and different islet cell autoantibody pattern of latent autoimmune diabetes in Adults (LADA) compared with Adult-onset type 1 diabetes with rapid progression. Diabetes Care 2003; 26: 452-7.         [ Links ]
27. Vanderwalle CL, Decraene T, Schuit FC, De Leeuw IH, Pipeleers DG, Gorus FK. Insulin autoantibodies and high titre islet cells antibodies are preferentially associated with the HLA DQA1*0301-DQB1*0302 haplotype at clinical onset of Type 1 (insulin-dependent) diabetes mellitus before age 10 years, but no at onset between age 10 and 40 years. Diabetologia 1993; 36: 1155-9.         [ Links ]
28. Tanaka S, Kobayashi T, Nakanishi K, et al. Association of HLA-DQ genotype in autoantibody-negative and rapid-onset type 1 diabetes. Diabetes Care 2002; 25: 2302-7.         [ Links ]
29. Lernamark A. Autoimmune diseases: are markers ready for prediction?. J Clin Invest 2001; 108: 1091-6.
        [ Links ]

Recibido: 13-08-2004
Aceptado: 4-04-2005