SciELO - Scientific Electronic Library Online

 
vol.68 número2Herpes zoster: Epidemiología y clínicaAnálisis de los premios a la investigación en gastroenterología: Experiencia en México índice de autoresíndice de materiabúsqueda de artículos
Home Pagelista alfabética de revistas  

Servicios Personalizados

Articulo

Indicadores

  • No hay articulos citadosCitado por SciELO

Links relacionados

  • En proceso de indezaciónCitado por Google
  • No hay articulos similaresSimilares en SciELO
  • En proceso de indezaciónSimilares en Google

Bookmark


Medicina (Buenos Aires)

versión On-line ISSN 1669-9106

Medicina (B. Aires) v.68 n.2 Ciudad Autónoma de Buenos Aires mar./abr. 2008

 

Polimorfismos en los genes CYP11a y CYP17 y etiología del hiperandrogenismo en pacientes con poliquistosis ovárica

María S. Pérez1, Gloria E. Cerrone1, Haydée Benencia2, Norma Márquez2, Eduardo De Piano2, Gustavo D. Frechtel1

1Cátedra de Genética y Biología Molecular, Facultad de Farmacia y Bioquímica, Universidad de Buenos Aires;
2Clínica de Endocrinología y Metabolismo Juan Reforzo Membrives, Buenos Aires

Dirección postal: Dr. Gustavo D. Frechtel, División Genética, Hospital de Clínicas José de San Martín, Av. Córdoba 2351, 1120 Buenos Aires, Argentina Fax: (54-11) 4964 8296 e-mail: gfrechtel@ffyb.uba.ar

Resumen

El síndrome de poliquistosis ovárica (PCOS) es un desorden endocrino-metabólico de naturaleza multifactorial, con una marcada predisposición genética, que afecta al 6% de las mujeres en edad reproductiva. Se caracteriza por la presencia de hiperandrogenismo, oligo-anovulación y ovarios poliquísticos. Entre los genes candidatos se encuentran aquellos que codifican para enzimas que actúan en la síntesis de andrógenos. Dos de los genes candidatos son el CYP17 y el CYP11a que codifican para la 17a hidroxilasa (P45017a) y para el P450scc (colesterol side chain cleavage) respectivamente. Los polimorfismos en estos genes están asociados al desarrollo del fenotipo hiperandrogénico. Nuestro objetivo fue analizar las frecuencias alélicas de los polimorfismos de los dos genes mencionados en población con PCOS, compararla con población normal y analizar la relación de cada variante alélica con el fenotipo hiperandrogénico correspondiente. Se analizaron 65 pacientes y 58 controles sanos en los que se determinaron niveles de testosterona y frecuencia de polimorfismos en los genes mencionados. Se observó una diferencia estadísticamente significativa cuando se asoció el grupo de mayor nivel de androgenemia con la presencia del genotipo A2/A2 del gen CYP17, y se hallaron mayores niveles de andrógenos circulantes en las pacientes con PCOS portadoras del alelo 216- del gen CYP11a. Nuestros resultados sugieren que ambos alelos juegan un rol menor en el desarrollo de PCOS y podrían ser considerados como potenciales marcadores de riesgo genético para el desarrollo del fenotipo hiperandrogénico.

Palabras clave: Síndrome de poliquistosis ovárica; Andrógenos; Polimorfismo genético

Abstract
Polymorphism in CYP11a and CYP17 genes and the etiology of hyperandrogenism in patients with polycystic ovary syndrome
. The polycystic ovary syndrome (PCOS) is a heterogeneous multifactorial endocrine metabolic disorder with genetic predisposition affecting 6% of women in the reproductive age. This syndrome is characterized by the presence of oligo-anovulation, hyperandrogenism and polycystic ovaries. Several genes have been postulated as responsible for the etiology of this disorder. Among these genes are those encoding the enzymes involved in the ovarian androgen biosynthesis. Two of the candidate genes are the CYP17 and the CYP11a, encoding the 17-a-hydroxylase (P45017a) and the cholesterol side chain cleavage (P450scc) respectively. The polymorphisms of these genes are linked to the development of an hyperandrogenic phenotype. The aim of this work was to analyze the allelic frequencies of such polymorphisms in a cohort of women with PCOS and to compare them with those of healthy women. Furthermore, the correlation between each allelic variant and the corresponding hyperandrogenic phenotype was also assessed. Therefore, 65 patients and 58 age matched healthy controls were analyzed. The serum levels of testosterone and the frequency of each polymorphism were determined. When the PCOS population was analyzed, a significant statistical difference was found when relating the group with the highest androgenemia level with the presence of A2/A2 genotype of CYP 17 gene, and a higher level of circulating androgen was found in PCO women carrying the 216- allele of CYP11a gene (that did not reach statistical significance). Our results suggest that both alleles play a minor role in the development of PCOS and could be a genetic risk marker of the hyperandrogenic phenotype.

Key words: Polycystic ovary syndrome; Androgens; Genetic polymorphism

El síndrome de ovarios poliquísticos (PCOS) es un desorden heterogéneo caracterizado por hiperandrogenismo, oligo-anovulación crónica y la presencia de ovarios poliquísticos. Este desorden, considerado uno de los más frecuentes en mujeres en edad reproductiva, alcanza aproximadamente a un 6% de esta población.
Si bien su etiología aún permanece sin esclarecerse, actualmente se lo considera un desorden de naturaleza multifactorial. Esta definición implica una predisposición poligénica caracterizada por la interacción de variaciones genéticas que ejercen un efecto menor en el desarrollo del fenotipo y la presencia de factores ambientales desencadenantes1.
Debido a que en este síndrome están afectadas básicamente dos vías endocrino-metabólicas: esteroideogénesis gonadal y acción periférica de la insulina, se han postulado numerosos genes candidatos para esclarecer la etiología genética del desorden. Entre estos genes se encuentran aquellos que codifican para enzimas que actúan en la síntesis de andrógenos.
Dos de los genes candidatos son los que codifican para la enzima 17a hidroxilasa o citocromo P45017a y para el citocromo P450scc (colesterol side chain cleavage) denominados CYP17 y CYP11a respectivamente2.
Numerosos estudios han tratado de relacionar las distintas variantes genéticas en los genes candidatos con el fenotipo presentado por las pacientes, pero los resultados son controvertidos. Esta situación puede deberse entre otras cosas a la heterogeneidad del síndrome, los diferentes criterios diagnósticos utilizados, y por los diferentes background genéticos de las poblaciones estudiadas.
Hay numerosas publicaciones donde se avala la aumentada expresión de P45017a y P450scc en células de la teca de ovarios de pacientes con PCOS3-5.
P45017a es una enzima clave en la síntesis de andrógenos, tanto en gónadas como en glándula adrenal. El gen que codifica para dicha enzima se localiza en el brazo largo del cromosoma 10. Se ha descrito un polimorfismo de nucleótido único (SNP) en el promotor de este gen, que se encuentra a -34 bases del sitio de iniciación, y corresponde a una sustitución de T/C que genera un nuevo sitio de unión al factor de trascripción Sp1, situación que se postula como la causa de un aumento en la expresión de dicho gen6.
Los alelos generados por el SNP mencionado son: A1 que presenta T y A2 que presenta C en dicha posición. La presencia de la variante alélica A2 se asoció con un exceso de andrógenos circulantes.
El paso limitante en la esterodeogénesis, tanto a nivel gonadal como adrenal, después de la introducción del colesterol a la mitocondria está catalizado por la enzima P450scc. El gen que codifica para dicha enzima se localiza en el cromosoma 15 y presenta un polimorfismo que consiste en un microsatélite ubicado en el promotor del gen CYP11a, este microsatélite es un repetitivo de un penta nucleótido (TTTTA)n que se ubica a -528 bases del sitio de inicio del gen. El número de repeticiones descripto en la literatura es de n:4, 6, 8 y 9. El alelo más frecuente es el n:4, y da origen al denominado alelo 216+; y los alelos con n diferente a 4 que dan origen al alelo 216- se asociaron al desarrollo del fenotipo hiperandrogénico de las pacientes con PCOS. Se postuló que este microsatélite actuaría como enhancer en la expresión de dicho gen, y por lo tanto la presencia del alelo 216- se asoció con un exceso de andrógenos circulantes7.
El objetivo de este trabajo fue analizar las frecuencias alélicas de los polimorfismos de los dos genes mencionados en población con PCOS, compararlas con población normal y analizar la relación de cada variante alélica con el fenotipo hiperandrogénico correspondiente.

Materiales y métodos

Se analizaron muestras provenientes de pacientes con diagnóstico de PCOS según los criterios diagnósticos de Rótterdam 2003, que acudieron al Servicio de Ginecología de la Clínica de Endocrinología y Metabolismo Dr. Reforzo Membrives. Todas las pacientes firmaron el correspondiente consentimiento informado.
Se estudiaron las siguientes poblaciones:
-65 pacientes con diagnóstico confirmado de PCOS.
-58 controles sanos de sexo femenino.
Se determinó el nivel de testosterona circulante por medio de la técnica de radioinmunoanálisis (RIA). Las pacientes afectadas con PCOS presentaban amenorrea. Las muestras en los controles normales fueron tomadas dentro de los primeros 5 días del ciclo.

Análisis moleculares

El SNP del gen CYP17 se realizó por medio de la técnica reacción en cadena de la polimerasa (PCR) y posterior análisis de polimorfismo de longitud de los fragmentos de restricción (PCR-RFLP), ya que la sustitución suprime un sitio de restricción para la enzima MspA1I.
El ácido desoxirribonucleico (ADN) se purificó por la técnica con bromuro de cetil trimetil amonio (CTAB), a partir de sangre periférica.
Se amplificó por PCR la zona del promotor del gen CYP17 que abarca la presencia del polimorfismo T/C en la posición -34 pares de bases del sitio de iniciación. Para ello se utilizaron primers específicos, cuyas secuencias nucleotídicas son las siguientes:
Primer Sense: 5'CATTCGCACTCTGGAGTC 3'
Primer Antisense: 5'AGGCTCTTGGGGTCATTG 3'
La reacción de amplificación se realizó con productos GIBCO, BRL en un volumen final de 100 µl, según el siguiente protocolo: MgCl2 2.0 mM, dNTP200 µM de cada uno, primers 80 pm de cada uno, ADN 200 ng. Condiciones de ciclado: desnaturalización inicial de 4 minutos a 94 °C, seguido por 30 ciclos de desnaturalización a 94 °C durante 60 segundos, annealing: 59 °C durante 60 segundos, extensión: 72 °C durante 60 segundos y una extensión final: 72 °C durante 10 minutos.
El tamaño del fragmento esperado es de 459 pb. Se digirieron 10 µl del producto de PCR con 10 U de MspA1I. Los fragmentos de restricción se analizaron en un gel de agarosa al 4%.
El microsatélite del gen CYP 11a, se estudió con la técnica de PCR y posterior análisis en gel de poliacrilamida.
Se amplificó la zona del promotor del gen CYP11 que abarca el microsatélite de 5 pb (tttta) n. Para ello se utilizaron primers específicos, cuyas secuencias nucleotídicas son las siguientes:
Primer Sense: 5'GGTGAAACTGTGCCATTGC 3'
Primer Antisense: 5'GTTTGGGGGAAATGAGGGGC 3'
La reacción de amplificación se realizó con productos GIBCO, BRL en un volumen final de 100 µl, según el siguiente protocolo: ADN 200 ng, MgCl2 2.0 mM, dNTP 150 µM de cada uno, primers 40 pm de cada uno. Condiciones de ciclado: desnaturalización inicial: 94 °C durante 5 minutos; 30 ciclos de desnaturalización: 94 °C durante 1 minuto, annealing: 63 °C durante 1 minuto, extensión: 72 °C durante 1 minuto, extensión final: 72 °C durante 10 minutos.
Tamaño del producto amplificado: 216 (n: 4), 226 (n: 6), 236 (n: 8), o 241pb (n: 9) de acuerdo al alelo presente en las muestras.
El análisis de los productos de amplificación se realizó en geles de poliacrilamida al 8%.

Análisis estadístico

El estudio de asociación de las variables bioquímicas con los diferentes genotipos se realizó mediante el análisis de las varianzas. La distribución de los diferentes genotipos en cada uno de los grupos se analizó mediante la prueba de χ2. Las frecuencias alélicas de los diferentes polimorfismos se analizaron mediante tablas de contingencia de 2x2 utilizando el software Graph Pad Instat; p<0.05 fueron consideradas estadísticamente significativas. Se estimó el riesgo relativo como odds ratio (OR) junto a su intervalo de confianza al 95% (IC) mediante la aproximación de Wolf.

Resultados

La genotipificación de los polimorfismos de ambos genes se realizó en las dos poblaciones estudiadas. Los análisis estadísticos aplicados no mostraron una diferencia estadísticamente significativa en la frecuencia de aparición de dichos polimorfismos entre ambas poblaciones. (Tablas 1 a 4) Figs. 1, 2.

TABLA 1.- Frecuencias genotípicas del gen CYP17

TABLA 2.- Relación fenotipo-genotipo de acuerdo al nivel de andrógenos

TABLA 3.- Relación fenotipo-genotipo de acuerdo al nivel de andrógenos

TABLA 4.- Frecuencias alélicas del gen CYP11a


Fig. 1
.- Gen CYP17. Análisis por RFLP. Mapa de restricción del producto de PCR digerido con la enzima MspA1I.
1: Producto sin digerir. 2, 8, 11,13: Portadores de C homocigotas. (Alelo A2). 3, 4, 5, 7, 9: Portadores de C/T heterocigotas. (Alelos A1/A2). 6, 10, 12: Portadores de T homocigotas. (Alelo A1). M: Marcador de peso molecular de 50 pb.


Fig. 2
.- Gen CYP11a. Análisis en gel de poliacrilamida al 8% del producto de amplificación.
1: Alelo 241/216. 2: Alelo 226. 3: Alelo 216/226. 4: Alelo 216. M: marcador con fragmentos de los cuatro tamaños esperados

Al dividir la población de PCOS de acuerdo al valor de testosterona biodisponible, usando como valor de corte el límite superior normal: 0.12 ng/ml, se observó una diferencia estadísticamente significativa entre ambos grupos en la distribución del alelo A2 en forma homocigota (p: 0.006; OR: 6.0; IC 1.65-22.1) (Tabla 3).
El análisis estadístico de los resultados no mostró diferencias significativas en los valores de testosterona biodisponible entre los diferentes genotipos cuando se estudiaron las poblaciones en forma individual, pero es importante destacar que en las pacientes con PCOS portadores del alelo A2, que incluyen los portadores de los genotipos homocigotas y heterocigotas (A1A2 A2/A2) el valor medio de testosterona biodisponible está por encima del valor de corte establecido como normal (0.12 ng/ ml) en tanto que en el grupo portador del genotipo A1/A1 dicho valor medio se mantiene en el rango de normalidad (Tabla 2).
El análisis del nivel de andrógenos plasmáticos en las distintas poblaciones portadoras de los genotipos 216+ y 216- se describe en la Tabla 5.

TABLA 5.- Parámetros bioquímicos.

Si bien el análisis de los niveles de testosterona biodisponible entre las dos poblaciones portadoras de los distintos alelos no alcanza significación estadística entre ellos, se observa que la población de PCOS portadora del alelo 216- presenta un valor medio del nivel de testosterona biodisponible mayor que el rango normal, mientras que el grupo portador del alelo 216+ presenta un valor medio de dicha hormona en el rango de normalidad.

Discusión

PCOS es una enfermedad de origen multifactorial caracterizado por un fenotipo hiperandrogénico en el cual se ha definido la resistencia a la insulina como componente fisiopatológico fundamental por la acción de la misma en el ovario8, 9.
El hiperandrogenismo funcional, principalmente de origen ovárico, que constituye una característica patognomónica del síndrome de poliquistosis ovárica, presenta una agregación familiar y hay hallazgos que sugieren que existen componentes hereditarios que favorecen el desarrollo del mismo, y por lo tanto la aparición de este desorden hormonal.
Se analizaron dos genes candidatos cuyos polimorfismos contribuirían al desarrollo del fenotipo hiperandrogénico característico de la enfermedad.
La enzima 17-20a hidroxilasa 17-20 liasa cataliza un paso clave en la síntesis de andrógenos tanto en glándula adrenal como en ovario. Rosenfield y col., en 199010 describieron el concepto de una exagerada respuesta por parte de la glándula adrenal y del ovario, y nominaron a la enzima 17-20a hidroxilasa como la responsable de esta incrementada síntesis y secreción de andrógenos en las pacientes con PCOS.
En múltiples trabajos se ha asociado la presencia del alelo C con el aumento de testosterona plasmática en las pacientes con PCOS11, 12; sin embargo, otros informes han fallado en la búsqueda de esta asociación y lo han descrito como un polimorfismo sin consecuencias funcionales13.
El polimorfismo T/C en la región promotora del gen CYP17, crea un nuevo sitio de unión para el factor de transcripción Sp-1. Este sitio sería funcional y aumentaría la expresión del gen, y por lo tanto la producción de andrógenos en las células de la teca del ovario7. Por otro lado, también fue confirmado que los niveles de ARNm de CYP17 como de CIYP11 en células de la teca del ovario estaban aumentados en las muestras provenientes de pacientes con PCOS con respecto a muestras de un grupo de mujeres sanas. El mecanismo propuesto para explicar el incremento en la expresión de estos genes reside en las diferencias genéticas de los promotores de dichos genes14, 15.
Sin embargo autores como Daneshmand, no consideran que este nuevo sitio de unión al factor Sp-1 presente características funcionales, y adjudican las diferencias en el grado de expresión de este gen a variables de otra índole13.
En el actual trabajo, se estudiaron y compararon las frecuencias alélicas y genotípicas del polimorfismo entre una población con PCOS y un grupo normal, y no se encontraron diferencias estadísticamente significativas al comparar los datos de ambas poblaciones. Sin embargo se estudió el grupo de pacientes con PCOS en forma particular y se tomó el valor superior normal de corte de testosterona biodisponible; se clasificó a la población en dos grupos, uno con testosterona biodisponible <12 ng/ ml y otro con testosterona biodisponible < 12 ng/ml.
Se obtuvo una diferencia estadísticamente significativa asociando el grupo de mayor nivel de androgenemia con la mayor frecuencia del alelo A2. De esta manera se relaciona directamente la presencia de este alelo a una incrementada producción de andrógenos.
En el análisis genotipo-fenotipo de la población con PCOS, a pesar que las diferencias no fueron estadísticamente significativas, podemos observar que la presencia de los genotipo A1/A2, A2 /A2 se correlacionan con un nivel de androgenemia por encima del punto de corte considerado normal.
De esta manera, de acuerdo a los resultados expuestos, se puede inferir que este polimorfismo T/C sería al menos uno de los responsables de la desregulación en la síntesis de andrógenos que presentan las portadoras del alelo C.
Si bien se ha excluido a este polimorfismo como causa principal del hiperandrogenismo no se descarta a este gen como uno de los genes candidatos cuyo SNP contribuye a aumentar la síntesis y secreción de andró-genos en las células del ovario.
El segundo de los genes candidatos analizados con respecto del fenotipo hiper-androgénico de las pacientes con PCOS, fue el gen CYP11a, cuyo producto de expresión es la enzima P450scc. Esta enzima cataliza el paso limitante en la esteroideogénesis como lo es la conversión de colesterol en pregnenolona.
De acuerdo a investigaciones realizadas en cultivo de células de la teca del ovario de pacientes con PCOS, se observó un mayor grado de expresión de este gen en estas células provenientes de pacientes con PCOS, con respecto a los cultivos de células provenientes de controles sanos15.
El alelo más frecuente en este microsatélite es el que presenta un número de repeticiones igual a 4, alelos con mayores números de repeticiones; estos fueron asociados a fenotipos hiper-androgénicos.
Gharani y col. informaron en 1997 la presencia de repeticiones con n ≠ 4 en este microsatélite en pacientes con PCOS16 que fue asociada con elevados niveles de testosterona plasmática en este grupo de pacientes. Estos resultados fueron confirmados por otros autores como D. Kandarakis17, pero no avalados por otros grupos de investigadores como Daneshmand2, 13, 14.
Se postuló que este microsatélite en la región promotora del gen participaría en la regulación de la expresión de dicho gen, provocando anormalidades en la síntesis de andrógenos tanto en ovario como en glándula adrenal, debido a que esta enzima es el paso limitante en dicha síntesis en ambos órganos.
En el presente trabajo se comparó la frecuencia de aparición del alelo n = 4 en la población con PCOS y una población normal. No se halló una diferencia estadísticamente significativa entre ambas poblaciones, pero al comparar el nivel de testosterona biodisponible entre el grupo portador del alelo n = 4 y el grupo portador del alelo n ≠ 4, se observó que el grupo portador del alelo n ≠ 4 poseía niveles de testosterona biodisponible más elevado que el otro. Estas observaciones podrían reflejar una regulación positiva por parte del alelo n ≠ 4 en la expresión del gen CYP11a y por lo tanto en la síntesis de andrógenos (Tabla 5).
Si bien esta desregulación en la síntesis de andrógenos en las pacientes con PCOS, sugiere la presencia de algún defecto intrínseco en esta vía metabólica responsable de la producción de andrógenos, también se debe considerar el estímulo sostenido por parte de la LH sobre las células de la teca y la acción sinérgica de la insulina en las mismas células.
Con estos resultados, concluimos que ambos polimorfismos cumplen un rol funcional y podrían ser considerados como uno de los potenciales marcadores de riesgo genético para el desarrollo del fenotipo hiperandrogénico en pacientes con PCOS.

Agradecimientos:
este trabajo fue subsidiado por el Instituto Universitario de Ciencias de la Salud, Facultad de Medicina, Fundación H.A. Barceló.
Los autores agradecen a la Dra. María del Carmen Masselli por la realización del dosaje de andrógenos plasmáticos.

Bibliografía

1. Ramírez Luque M, San Millán J, Escobar Morreale. Genomic variants in polycystic ovary syndrome. Clinica Chimica Acta 2006; 366: 14-26.         [ Links ]

2. Urbanek M, Legro RS, Driscoll DA, et al. Thirty seven genes for polycystic ovary syndrome: strongest evidence for linkage is with folistatin. Proc Natl Acad Sci USA 1999; 96: 8573-8.         [ Links ]

3. Qin KN, Rosenfield RL. Role of cytochrome P450c17 in polycystic ovary syndrome. Mol Cell Endocrinol 1998; 145: 111-21.         [ Links ]

4. Wood JR, Ho CK, Nelson-Degrave VL, McAllister JM, Strauss JF 3rd. The molecular signature of polycystic ovary syndrome (PCOS) theca cells defined by gene expression profiling. J Reprod Immunol 2004; 63: 51-60.         [ Links ]

5. Nelson VL, Legro RS, Strauss JF, et al. Augmented androgens production is a stable steroidogenic phenotype of propagated theca cells from polycystic ovaries. Mol Endo 1999; 13: 6946-57.         [ Links ]

6. Carey AH, Waterworth D, Patel K, et al. Polycystic ovaries and premature male pattern baldness are associated with one allele of the steroid metabolism gene CYP17. Hum Mol Gen 1994; 3: 1873-6.         [ Links ]

7. Gharani N, Waterworth DM, Batty S, et al. Association of the steroid synthesis gene CYP11a with polycystic ovary syndrome and hyperandrogenism. Hum Mol Gen 1997; 6: 397-402.         [ Links ]

8. Dunaif A. Insulin resistance and the polycystic ovary syndrome: mechanism and implications for pathogenesis. Endocr Rev 1997; 18: 774-800.         [ Links ]

9. Dunaif A, Segal KR, Futterweit W, Dobrjansky A. Profound peripheral insulin resistance, independent of obesity, in polycystic ovary syndrome. Diabetes 1989; 38: 1165-74.         [ Links ]

10. Rosenfield RL, Barnes RB, Cara JF, Lucky AW. Dysregulation of cytochrome P450c17a as the cause of polycystic ovarian syndrome. Fertil Steril 1990; 53: 785-91.         [ Links ]

11. Wickenheisser JK, Quinn PG, Nelson VL, Legro RS, Strauss JF 3rd, McAllister JM. Differential activity of the cytochrome P450 17a hydroxylase and steroidogenic acute regulatory protein gene promoters in normal and polycystic ovary syndrome theca cells. J Clin Endocrinol Metab 2000; 58: 2304-11.         [ Links ]

12. Nelson VL, Legro RS, Strauss III JF, McAllister JM. Augmented androgen production is a stable steroidogenic phenotype of propagated theca cells from polycystic ovaries. Mol Endocrinol 1999; 13: 946-57.         [ Links ]

13. Daneshmand S, Weitsman SR, Navab A, Jakimiuk AJ, Magoffin DA. Overexpression of theca-cell messenger RNA in polycystic ovary syndrome does not correlate with polymorphisms in the cholesterol side chain cleavage and 17alpha hydroxylase/C (17-20) lyase promoters. Fert Steril 2002; 77: 274-80.         [ Links ]

14. San Millan JL, Sancho J, Calvo RM, Escobar Morreale HF. Role of the pentanucleotide (tttta)n polymorphism in the promoter of the CYP11a gene in the pathogenesis of hirsutism. Fert Steril 2001; 75: 797-802.         [ Links ]

15. Mooser V, Mancini FP, Bopp S, et al. Sequence polymorphisms in the apo (a) gene associated with specific levels of Lp(a)in plasma. Hum Mol Genet 1995; 4: 173-81.         [ Links ]

16. Gharani N, Waterworth DM, Williamson R, Franks S. 5'Polymorphism of the CYP17 gene is not associated with serum testosterone levels in women with polycystic ovary. J Clin Endocrinol Metab 1996; 81: 4174.         [ Links ]

17. Diamanti-Kandarakis E, Bartzis MI, Bergiele AT, Tsianatelli TC, Kouli CR. Microsatellite polymorphism (tttta)n at -528base pairs of gene CYP11a influences hyperandrogenemia in patients with polycystic ovary syndrome. Fert Ster 2000; 73: 735-41.         [ Links ]

Recibido: 3-04-2007
Aceptado: 10-01-2008