SciELO - Scientific Electronic Library Online

 
vol.38 número1Análisis de la expresión diferencial de genes celulares luego de la infección por Adenovirus 7h por técnicas de bioarraysDetección de Escherichia coli O157: H7 en carne picada fresca y hamburguesas congeladas índice de autoresíndice de materiabúsqueda de artículos
Home Pagelista alfabética de revistas  

Servicios Personalizados

Articulo

Indicadores

  • No hay articulos citadosCitado por SciELO

Links relacionados

  • En proceso de indezaciónCitado por Google
  • No hay articulos similaresSimilares en SciELO
  • En proceso de indezaciónSimilares en Google

Bookmark


Revista argentina de microbiología

versión On-line ISSN 1851-7617

Rev. argent. microbiol. v.38 n.1 Ciudad Autónoma de Buenos Aires ene./mar. 2006

 

Prevalencia de metalo-β-lactamasas en Pseudomonas aeruginosa resistentes a carbapenemes en un Hospital Universitario de Buenos Aires

G. Pagniez1,2, M. Radice2*, A. Cuirolo2, O. Rodríguez3, H. Rodríguez3, C. Vay3, A. Famiglietti3, G. Gutkind2

1Carrera de Especialización en Bioquímica Clínica, área Bacteriología Clínica, Escuela de graduados; 2Cátedra de Microbiología, Facultad de Farmacia y Bioquímica, Universidad de Buenos Aires; Junín 954, (1113) Ciudad Autónoma de Buenos Aires; Laboratorio de Bacteriología Clínica, Departamento de Bioquímica Clínica, Hospital de Clínicas José de San Martín, Facultad de Farmacia y Bioquímica, Universidad de Buenos Aires; Córdoba 2150, (1113) Ciudad Autónoma de Buenos Aires.
*Correspondencia. E-mail: mradice@ffyb.uba.ar

RESUMEN
Se estudiaron 91 aislamientos de Pseudomonas aeruginosa resistentes a carbapenemes con el objetivo de conocer la prevalencia de metalo-β-lactamasas y evaluar la habilidad del ensayo de inhibición empleando discos de EDTA (1 μmol) en su detección. Se determinó la presencia de carbapenemasas en 10 (11%) de los aislamientos recuperados. La sensibilidad a aztreonam en los aislamientos resistentes a ambos carbapenemes resultó un buen predictor de la presencia de estas enzimas. Dichas carbapenemasas correspondieron a la enzima VIM-2 en tres de ellos y a VIM-11 en otros siete. En todos los casos los genes codificantes de estas enzimas se encontraron localizados en integrones de clase 1 seguidos corriente abajo de genes codificantes de enzimas acetilantes de antibióticos aminoglucosídicos. El ensayo de detección fenotípica de metalo-β-lactamasas empleando discos de EDTA mostró un 100% de especificidad y sensibilidad en la detección de estas enzimas en la población de Pseudomonas aeruginosa analizadas.
Palabras clave: metalo-β-lactamasas, resistencia a carbapenemes, carbapenemasas

ABSTRACT
Prevalence of metallo-β-lactamase in carbapenem resistant Pseudomonas aeruginosa at an University Hospital of Buenos Aires City
. The present study was conducted to estimate the prevalence of metallo-β-lactamases in 91 consecutive carbapenem resistant Pseudomonas aeruginosa isolates, recovered from inpatients at Hospital de Clínicas in Buenos Aires. Both, phenotypic and genotypic methods detected the presence of carbapenemases in 10 (11%) isolates, corresponding to VIM-11 in 7/10 and VIM-2 in the others. Codifying genes were all included in class 1 integrons, upstream genes coding for aminoglycoside modifying enzymes. One hundred percent sensitivity and specificity was achieved by the metallo-β-lactamases phenotypic screening method using EDTA (1 µmol) disks in the Pseudomonas aeruginosa isolates included in this study. Sensitivity to aztreonam in carbapenem resistant isolates was suspicious of the presence of these enzymes.
Key words: metallo-β-lactamases, carbapenem resistance, carbapenemases

INTRODUCCIÓN
Pseudomonas aeruginosa constituye uno de los patógenos aislados con mayor frecuencia en pacientes internados. El tratamiento de las infecciones graves causadas por este microorganismo suele ser dificultoso ya que, por un lado P. aeruginosa es naturalmente resistente a una gran variedad de antimicrobianos y, además, puede adquirir mecanismos de resistencia para prácticamente la totalidad de los antimicrobianos disponibles para su tratamiento. Por ello, es cada vez más frecuente la necesidad de emplear los carbapenemes, antibióticos β-lactámicos de amplio espectro y con actividad contra la mayoría de los patógenos, con la consiguiente selección de aislamientos resistentes que se refleja en el 26% de resistencia a ambos carbapenemes informado por el programa de relevamiento de la resistencia SIR (Sistema Informático de Resistencia) para el período 2002-2003 (Informe SIR 2002-2003, www.aam.org.ar).
P. aeruginosa puede exhibir resistencia tanto en forma disociada a imipenem (IMI) o meropenem (MER) como también a ambos carbapenemes simultáneamente. La resistencia sólo a MER está frecuentemente asociada a la hiperproducción del sistema de eflujo constitutivo MexA-MexB-OprM (12). Por su parte, el mecanismo de resistencia a IMI más común es la impermeabilidad originada por el déficit de la proteína OprD (21), sumado a la presencia de β-lactamasas cromosómicas tipo AMP-C (11). En algunas ocasiones la expresión del sistema de eflujo denominado MexE-MexF-OprN podría estar implicado en la resistencia a IMI (12). La resistencia simultánea a ambos carbapenemes indica, o bien la co-existencia de dichos mecanismos, o la producción de enzimas con capacidad de hidrolizarlos, denominadas carbapenemasas (10). Estas pueden corresponder a serino-enzimas o metalo-β-lactamasas (MBLs). Las serino-carbapenema-sas son enzimas de clase A o D de Ambler (1) y son responsables, en general, de la resistencia a carbapenemes en enterobacterias y Acinetobacter spp., respectivamente. Las MBLs, pertenecientes a la clase B de Ambler, y al grupo 3 de la clasificación de Bush et al. (4), constituyen las carbapenemasas adquiridas de mayor relevancia clínica ya que tienen capacidad de hidrolizar a todos los antibióticos β-lactámicos, excepto el aztreonam (AZT) y no ser inhibidas por los inhibidores suicidas. En cambio, quelantes como el EDTA, el ácido dipicolínico o derivados del ácido succínico, entre otros, interaccionan con el Zn2+, necesario para su acción, pero ninguno de ellos presentó utilidad clínica (10).
Existen dos tipos dominantes de MBLs, IMP y VIM, cada uno con múltiples variantes alélicas (18). Las enzimas tipo IMP fueron descriptas inicialmente en Japón en 1991 y han sido comunicadas frecuentemente en enterobacterias y bacterias gram-negativas no fermentadoras (25), mientras que las VIM fueron detectadas originalmente en Europa en 1999, y han sido descriptas fundamentalmente en P. aeruginosa y otros no fermentadores (7). La enzima SPM-1, descripta en 1997, y la GIM-1 son también MBLs, cuyas secuencias difieren significativamente de las enzimas tipo IMP y VIM (5, 23). Recientemente se ha reportado una nueva MBL denominada SIM-1 (8). Prácticamente todos los genes codificantes conocidos de las enzimas tipo IMP y VIM, así como GIM-1, se encuentran como genes en cassette localizados en integrones de clase 1, asociados a genes codificantes de enzimas modificadoras de aminoglucósidos (22, 24). Aunque pueden localizarse en integrones de clase 3 (24). Los integrones tienen la capacidad de reclutar genes en cassette por un mecanismo de recombinación sitio específico entre un elemento de 59 pares de bases en el gen en cassette y el sitio attI1 en el integrón (22). Si bien los genes en cassette tienen la posibilidad de desplazarse de un integrón a otro, estos últimos no son un sistema eficiente de transferencia entre bacterias y por lo tanto no es inusual su inclusión dentro de otros elementos como transposones o plásmidos.
En los últimos años se ha registrado a nivel mundial, especialmente en Europa y Asia, un notable incremento en el informe de nuevas MBLs y en la diseminación entre microorganismos relacionados e incluso no relacionados (9, 13). Sin embargo, en nuestro país la presencia de estas enzimas fue detectada por primera vez en el año 2002 (19). Debido a que la resistencia a carbapenemes en P. aeruginosa, a diferencia de lo que sucede con las enterobacterias, es frecuente en nuestro medio y considerando que distintos mecanismos pueden contribuir a la misma, es probable que sin la búsqueda activa, la participación de las MBLs en los aislamientos clínicos haya sido subestimada.
Teniendo en cuenta la capacidad de los quelantes para interactuar con el Zn2+ del sitio activo, muchos ensayos fenotípicos empleados en la detección de MBLs han empleado distintas combinaciones de este tipo de inhibidores (24). Sin embargo, ningún método fenotípico ha sido suficientemente estandarizado o recomendado para la temprana detección de MBLs en el laboratorio de bacteriología en la atención primaria.
En este sentido se encaró un estudio destinado a conocer la prevalencia de MBLs en P. aeruginosa resistentes a carbapenemes en un Hospital Universitario de Buenos Aires donde se observa un nivel de resistencia comparable al informado a nivel nacional (26%). También se propuso evaluar la habilidad del ensayo de inhibición empleando discos de EDTA en la detección de estas enzimas.

MATERIALES Y MÉTODOS

Microorganismos: se estudiaron 91 aislamientos consecutivos y no repetitivos de P. aeruginosa provenientes de pacientes internados en distintas salas del Hospital de Clínicas “José de San Martín”, obtenidos en dos cortes de prevalencia. El primer corte correspondió a dos meses: junio-julio del 2002 (n=8) y el segundo a un año calendario: diciembre 2003 - diciembre 2004 (n=83). En ambos casos el criterio de selección de los microorganismos fue la resistencia a MER y /o IMI, determinado por el método de dos concentraciones de Marcenac et al. (14), utilizando los criterios de sensibilidad del CLSI (ex NCCLS) (16).

Caracterización fenotípica de la resistencia
Determinación de la sensibilidad
: se determinó la sensibilidad a distintos antibióticos β-lactámicos y no β-lactámicos por el ensayo de difusión en medio sólido según las recomendaciones del CLSI (17). Se ensayaron los siguientes antibióticos: piperacilina (100 μg) (PIP), piperacilina-tazobactam (100/ 10 μg) (PTZ), ceftacidima (30 μg) (CAZ), cefepima (30 μg) (FEP), AZT (30 μg), IMI (10 μg), MER (10 μg), amicacina (30 μg) (AKN), gentamicina (10 μg) (GEN), cipro-floxacina (5 µg) (CIP), (Laboratorio Britania, Argentina).
Detección fenotípica de MBLs: se empleó una modificación del ensayo de sinergia descripto inicialmente por Arakawa (2). Para ello se inocularon las placas según las recomendaciones del CLSI para la prueba de difusión por disco. Se colocaron discos conteniendo EDTA (1 μmol) y discos comerciales conteniendo CAZ, IMI y MERO, a 15 mm de distancia de centro a centro, del primero. Un agrandamiento (“efecto huevo”) en el halo de inhibición del disco conteniendo el antibiótico en la zona adyacente al disco conteniendo el inhibidor, fue interpretado como posible presencia de MBL.

Caracterización genotípica de la resistencia
Detección de la presencia de los genes codificantes de las MBLs
: se amplificaron los genes codificantes por la reacción en cadena de la polimerasa (PCR) empleando cebadores para las familias de MBLs más ampliamente diseminadas, utilizando como molde ADN total. Se emplearon los siguientes pares de oligonucleótidos (5´-3´):
IMP-AF: GAAGGCGTTTATGTTCATACTT, IMP-AR: GTTTT-GCCTTACCATATTTGGA
VIMG-F: ATGGTGTTTGGTCGCATATC, VIMG-R: TGGG-CCATTCAGCCAGATC
Los parámetros de amplificación fueron: 95 °C, 5 minutos; seguido de 30 ciclos de 1 minuto a 95 °C, 1 minuto a 52 °C, 1 minuto a 72 °C, y un período de extensión final de 20 minutos a 72 °C.
Determinación de la localización de los genes codificantes de MBLs: empleando como molde ADN total se amplificaron los genes codificantes de la integrasa y el fragmento correspondiente a la región variable de integrones de clase 1, empleando los pares de oligonucleótidos (5'-3') que se detallan más adelante. Los parámetros de amplificación fueron: 95 °C, 5 minutos; seguido de 30 ciclos de 95 °C 1 minuto, 52 °C 1 minuto y 72 °C 2 minutos, y un período de extensión final de 20 minutos a 72 °C.
IntI1 R: GCGTTCGGTCAAGGTTCTGG, IntI1 F: ACCGCC-AACTTTCAGCACAT,
3’CS: AAGCAGACTTGACCTGA, 5’CS: GGCATCCAAG-CAGCAAG
A su vez, empleando como molde los fragmentos amplificados de región variable, se intentó la amplificación de los genes codificantes de las MBLs detectadas en el punto anterior, empleando los mismos cebadores y parámetros de amplificación.
Secuenciación de los productos amplificados: se determinaron las secuencias nucleotídicas de los distintos fragmentos amplificados empleando el sistema ABI Prism DNA 3700. Se empleó la herramienta Blast (Basic Local Alignment Search Tool) del NCBI (National Center for Biotechnology Information) para comparar las secuencias obtenidas con las secuencias génicas depositadas en base de datos (www.ncbi.nlm.nih.gov/blast).
Determinación del valor predictivo del ensayo de sensibilidad a AZT en la detección de MBLs: se calculó el valor predictivo positivo (VP+) y el valor predictivo negativo (VP-) en los aislamientos resistentes a ambos carbapenemes. Se emplearon las siguientes fórmulas:
VP+ = verdaderos positivos / verdaderos positivos + falsos positivos
VP- = verdaderos negativos/ verdaderos negativos + falsos negativos
Verdaderos positivos: total de aislamientos productores de MBLs, detectados por amplificación por PCR de los genes codificantes, y detectados también por presentar sensibilidad a AZT.
Falsos positivos: total de aislamientos sensibles a AZT donde no se detectaron genes codificantes de MBLs por PCR.
Verdaderos negativos: total de aislamientos donde no se detectó la presencia de genes codificantes de MBLs por PCR y que resultaron resistentes a AZT.
Falsos negativos: total de aislamientos donde se detectó la presencia de genes codificantes de MBLs por PCR y que resultaron resistentes a AZT.
Tipificación molecular de los aislamientos productores de MBLs: se empleó la técnica de amplificación de secuencias repetitivas por la reacción en cadena de la polimerasa (REP-PCR). Se emplearon los siguientes cebadores: REP-1: IIIGCGCCGICATCAGGC, REP-2: ACGTCTTATCAGGCCTAC
Las condiciones de amplificación fueron: 2 minutos a 94 °C, seguido de 30 ciclos de 94 °C, 30 segundos; 50 °C, 1 minuto; 72 °C, 4 minutos, y un período de extensión final de 7 minutos a 72 °C. Los productos amplificados se resolvieron en gel de agarosa al 1,5 % a 4,6 V/cm durante 3 horas. Se generó una matriz de similitud empleando el programa RAPDistance versión 1,4 (3), aplicando el coeficiente de Jaccard y luego se creó un dendrograma basado en el algoritmo UPGMA (unweighted pair group method with arithmetic averages) (6).

RESULTADOS

Caracterización fenotípica de la resistencia
Los perfiles de resistencia de los aislamientos fueron muy variados. Cinco de ellos fueron resistentes sólo a IMI y 6 lo fueron sólo a MER. El resto de los microorganismos, 80, fueron resistentes a ambos carbapenemes. La sensibilidad a los otros antibióticos ensayados se observan en la Tabla 1. Catorce aislamientos (17%) pertenecientes a este último grupo fueron resistentes a la mayoría de los antibióticos incluidos en el ensayo, pero resultaron sensibles a AZT. El VP+ de la sensibilidad a AZT en la detección de MBLs, en los aislamientos resistentes a ambos carbapenemes fue de 71%, mientras que el VP- 100%.

La detección fenotípica de MBLs fue positiva en 10/91 aislamientos, 1 correspondiente al primer corte y 9 correspondientes al segundo. Todos los aislamientos productores de MBLs fueron resistentes a ambos carba-penemes. Si bien se ensayaron en todos los casos la confrontación de IMI, MER y CAZ vs. EDTA, con CAZ se obtuvieron resultados reproducibles y más fáciles de observar comparado con los carbapenemes. En la Figura 1 se observa la sinergia entre EDTA-CAZ y EDTA-IMI. La sensibilidad y especificidad del ensayo de detección fenotípica fueron del 100%.

Caracterización genotípica de la resistencia
En 10 aislamientos se amplificó un fragmento de aproximadamente 0,4 kb cuando se emplearon los iniciadores para genes codificantes de enzimas tipo VIM, mientras que los resultados de los restantes aislamientos fueron negativos cuando se investigó la presencia de genes vim e imp. Estos 10 aislamientos productores de enzimas tipo VIM correspondieron a los mismos que fueran detectados por el ensayo de detección fenotípica empleando EDTA.
En los 10 aislamientos fue positiva la detección de la presencia de integrones de clase 1 por amplificación de intI1. Distintos fragmentos fueron obtenidos al amplificar la región variable de estos integrones. En 2 de los microorganismos se detectó la presencia de dos fragmentos correspondientes a regiones variables de aproximadamente 2,3 kb y 1,8 kb, en 5 de ellos un solo fragmento de aproximadamente 1,8 kb, y en los 3 restantes un fragmento de 1,7 kb. Empleando, a su vez, como molde estos fragmentos correspondientes a regiones variables se detectó la presencia del gen codificante de una enzima tipo VIM. En el primer caso se detectó la presencia de vim en el fragmento de 1,8 kb y no en el de 2,3 kb.
La secuenciación de los fragmentos amplificados permitió identificar la presencia del gen vim-11 (20) en las regiones variables de 1,8 kb, mientras que en las regiones variables de 1,7 kb se detectó el gen codificante de la enzima VIM-2. En todos los casos corriente abajo de los genes vim, en las regiones variables, se encontraron genes codificantes de enzimas modificadoras de aminoglucósidos de tipo acetilante.

Tipificación molecular
El dendrograma que resulta de analizar los perfiles electroforéticos obtenidos por REP-PCR muestra diferencias entre los aislamientos productores de MBLs incluidos en este estudio, indicando que no corresponden a un único clon.

DISCUSIÓN

Si bien los resultados obtenidos pertenecen a un solo centro y la situación epidemiológica es particular para las distintas instituciones del país, es importante notar que la prevalencia de MBLs en aislamientos de P. aeruginosa resistentes a carbapenemes, resultó al menos del 11%.
Los aislamientos productores de MBLs incluidos no correspondieron a un único clon, éstos fueron resistentes a ambos carbapenemes y a prácticamente la totalidad de los antibióticos ensayados excepto AZT, perfil que se observó también en 4 de los aislamientos no productores de MBLs. Por lo tanto, si bien la inclusión del disco de AZT en el antibiograma no tendría criterio clínico (24), la sensibilidad al mismo resultó un buen predictor de la presencia de este tipo de MBLs en P. aeruginosa resistentes a carbapenemes. En otros trabajos se han reportado microorganismos productores de MBLs resistentes a AZT, aunque esta resistencia quizás estaría mediada por otros mecanismos de resistencia presentes en P. aeruginosa y no por la hidrólisis enzimática de dicha droga mediada por MBLS. En este sentido, la resistencia a AZT en P. aeruginosa resistente a carbapenemes no descartaría la presencia de MBLs (24).
El método de detección de MBLs ensayado presentó un 100% de sensibilidad y especificidad en la población de P. aeruginosa estudiada en la cual se detectaron únicamente enzimas de tipo VIM. Por el contrario, Marchiaro et al. han descripto fallas en la detección de MBLs empleando discos conteniendo EDTA (15). Por lo tanto resulta conveniente evaluar el método de detección de MBLs en otros microorganismos y en presencia de otros tipos de MBLs emergentes, en particular SPM-1, que se disemina rápidamente en Brasil. En este sentido resulta necesario continuar con estudios que permitan evaluar la evolución de la prevalencia de las MBLs.
Los genes codificantes de las MBLs se encontraron, en todos los casos, como genes en cassette en la región variable integrones de clase 1, y teniendo en cuenta que estos elementos genéticos se encuentran ampliamente distribuidos en bacilos gram-negativos, este hecho podría favorecer la rápida adquisición de genes codificantes de MBLs por parte de microorganismos relacionados e incluso no relacionados. A su vez, estos integrones suelen localizarse dentro de elementos móviles como transposones o plásmidos conjugativos, lo cual incrementa la capacidad de diseminación de estos genes de resistencia.

Agradecimientos: Este trabajo fue financiado en parte por los subsidios ANPCyT, BID 1201/OC-AR PICT 14234 a Gabriel Gutkind y Fundación Roemmers a Marcela Radice.

BIBLIOGRAFÍA
1. Ambler R, Coulson A, Frère J, Ghuysen J, Joris B, Forsman M, et al. A standard numbering scheme for the class A β-lactamases. Biochem J. 1991; 276: 269-72.         [ Links ]
2. Arakawa Y, Murakami M, Suzuki K, Ito H, Wacharotayankun R, Ohsuka S, et al. A novel integron-like element carrying the metallo-β-lactamase gene blaIMP. Antimicrob Agents Chemother 1995; 39: 1612-15.         [ Links ]
3. Armstrong, J, Gibbs A, Peakall A, Weiller G. RAPDistance programs, version 1.04 for the analysis of patterns of RAPD fragments; Australian National University, Canberra, Australia 1994.         [ Links ]
4. Bush K, Jacoby G, Medeiros A. A functional classification scheme for β-lactamases and its correlation with molecular structure. Antimicrob Agents Chemother 1995; 39: 1211-33.         [ Links ]
5. Castanheira M, Toleman M, Jones R, Schmidt F, Walsh T. Molecular characterization of a β-lactamase gene, blaGIM-1 encoding a new subclass of metallo-β-lactamase. Antimicrob Agents Chemother 2004; 48: 4654-61.         [ Links ]
6. Kumar S, Tamura K, Nei M. MEGA: molecular evolutionary genetics analysis, version 1.02. 1993; The Pensylvania State University, University Park, Pa.         [ Links ]
7. Lauretti L, Riccio M, Mazzariol A, Cornaglia G, Amicosante G, Fontana R, et al. Cloning and characterization of blaVIM, a new integron-borne metallo-β-lactamase gene from a Pseudomonas aeruginosa clinical isolate. Antimicrob Agents Chemother 1999; 43: 1584-90.         [ Links ]
8. Lee K, Yum J, Lee Y, Kim H, Docquier J, Rossolini G, Chong Y. Novel acquired metallo-β-lactamase gene, blaSIM-1, in a class 1 integron from Acinetobacter baumannii clinical isolates from Korea. Antimicrob Agents Chemother 2005; 49: 4485-91.         [ Links ]
9. Livermore D. Carbapenemases: the next generation of β-lactamases. ASM News 1993; 59.         [ Links ]
10. Livermore D. Acquired carbapenemases. J. Antimicrob Chemother 1997; 39: 673-6.         [ Links ]
11. Livermore D. Interplay of impermeability and chromosomal β-lactamase activity in imipenem-resistant Pseudomonas aeruginosa. Antimicrob Agents Chemother 1992; 36: 2046-8.         [ Links ]
12. Livermore D. Of Pseudomonas, porins, pumps and carbapenems. J Antimicrob Chemother 2001; 47: 247-50.         [ Links ]
13. Livermore D, Woodford N. Carbapenemases: a problem in waiting?. Curr Opin Microbiol 2000; 3: 489-95.         [ Links ]
14. Marcenac F, Fernández A, Herran I, Civalero T. Semi-quantitative determination of resistance in agar. Arzneimittelforschung 1978; 28: 582-5.         [ Links ]
15. Marchiaro P, Mussi M, Ballerini V, Parsterán F, Viale A, Vila A, et al. Sensitive EDTA-based microbiological assays for detection of metallo-β-lactamases in nonfermentative gram-negative bacteria. J Clin Microbiol 2005; 43: 5648-52.         [ Links ]
16. National Committee for Clinical Laboratory Standards. Methods for dilution antimicrobial susceptibility tests for bacteria that grow aerobically; sixth edition, 2004; M7-A6. Wayne, Pa, USA.         [ Links ]
17. National Committee for Clinical Laboratory Standards. Performance standards for antimicrobial disk susceptibility tests; eight edition, 2004; M2-A8, Wayne, Pa, USA.         [ Links ]
18. Nordmann P, Poirel L. Emerging carbapenemases in gram-negative aerobes. Clin Microbiol Infect 2002; 8: 321-31.         [ Links ]
19. Pagniez G, Radice M, Amoroso A, Famiglietti A, Gutkind G. Class 1 integron containing a new variant of VIM-2 metallo-β-lactamase in Pseudomonas aeruginosa. 44th. Interscience Conference on Antimicrobial Agents and Chemotherapy, 2004, Abstract C1-p 293, Washington D.C., USA.         [ Links ]
20. Pasterán F, Faccone D, Petroni A, Rapoport M, Galas M, Vázquez M, et al. Novel variant (blaVIM-11) of the metallo-β-lactamase blaVIM family in a GES-1 extended-spectrum-β-lactamase-producing Pseudomonas aeruginosa clinical isolate in Argentina. Antimicrob Agents Chemother 2005; 49: 474-5.         [ Links ]
21. Tamber S, Ochs M, Hancock R. Role of the novel OprD family of porins in nutrient uptake in Pseudomonas aeruginosa. J. Bacteriol 2006, 188: 45-54.         [ Links ]
22. Toleman M, Rolston K, Jones R, Walsh T. blaVIM-7, an evolutionarily distinct metallo-β-lactamase gene in a Pseudomonas aeruginosa isolate from the United States. Antimicrob Agents Chemother 2004; 48: 329-32.         [ Links ]
23. Toleman M, Simm A, Murphy T, Gales A, Biedenbach D, Jones R, et al. Molecular characterization of SPM-1, a novel metallo-β-lactamase isolated in Latin America: report from the SENTRY antimicrobial surveillance programme. J Antimicrob Chemother 2002; 50: 673-9.         [ Links ]
24. Walsh T, Toleman M, Poirel L, Nordmann P. Metallo-β-lactamases: the quiet before de storm? Clin Microbiol Rev 2005; 18: 306-25.         [ Links ]
25. Watanabe M., Iyobe S., Inoue M. Transferable imipenem resistance in Pseudomonas aeruginosa. Antimicrob Agents Chemother 1991; 35: 147-51.
        [ Links ]

Recibido: 19/09/05
Aceptado: 8/03/06