SciELO - Scientific Electronic Library Online

 
vol.39 número2Biorrecuperación de ecosistemas acuáticos contaminados ¿Una misión imposible?Características fenotípicas útiles para la identificación presuntiva de Candida guilliermondii índice de autoresíndice de materiabúsqueda de artículos
Home Pagelista alfabética de revistas  

Servicios Personalizados

Articulo

Indicadores

  • No hay articulos citadosCitado por SciELO

Links relacionados

  • En proceso de indezaciónCitado por Google
  • No hay articulos similaresSimilares en SciELO
  • En proceso de indezaciónSimilares en Google

Bookmark


Revista argentina de microbiología

versión On-line ISSN 1851-7617

Rev. argent. microbiol. v.39 n.2 Ciudad Autónoma de Buenos Aires abr./jun. 2007

 

Estudio molecular de cepas argentinas de Bacillus anthracis

M. E. Pavan y F. Cairó*

Biochemiq S.A., Ing. Butty 240, 4º piso (C1001AFB) Ciudad Autónoma de Buenos Aires, Argentina

* Correspondencia. E-mail: fcairo@biochemiq.com

RESUMEN

Bacillus anthracis es una de las bacterias más monomórficas conocidas y los estudios epidemiológicos de este microorganismo se han visto dificultados por la falta de marcadores moleculares. El objetivo de este trabajo fue caracterizar molecularmente catorce cepas de campo argentinas y la cepa vacunal Sterne 34F2 sobre la base del estudio del locus vrrA, que contiene una repetición en tándem de número variable (VNTR) y presenta un polimorfismo con cinco variantes. También se ha tenido en cuenta la presencia o ausencia de los plásmidos de virulencia. Las cepas fueron aisladas de vacas, ovejas y cerdos durante brotes ocurridos en Buenos Aires, Entre Ríos, Santa Fe y La Pampa durante los últimos cincuenta años. Todas las cepas de campo presentaron los plásmidos pXO1 y pXO2, con excepción de una cepa aislada de cerdo que únicamente presentó el plásmido pXO2. Todos los aislamientos y la cepa vacunal pertenecieron a la misma variante molecular de VNTR, que se definió secuenciando el locus vrrA de tres de los aislamientos y de la cepa 34F2. Estas secuencias fueron completamente idénticas y correspondieron a la variante VNTR4; así, las catorce cepas argentinas de B. anthracis estudiadas mostraron una gran uniformidad a nivel molecular, aun cuando se habían aislado de diferentes especies de mamíferos, en un amplio período de tiempo y en una extensa zona geográfica.

Palabras clave: Bacillus anthracis; Tipificación; Repeticiones en tándem de número variable; VNTR; vrrA gene; PCR

ABSTRACT

Molecular study of Argentine strains of Bacillus anthracis. Bacillus anthracis is one of the most monomorphic bacteria known and epidemiological studies of this microorganism have been hampered by the lack of molecular markers. For the genotyping of fourteen Argentine field strains and the vaccine strain Sterne 34F2, the presence or absence of the virulence plasmids as well as vrrA locus containing a variable-number tandem repeat (VNTR) and presenting a polymorphism involving five variants, were analyzed. Strains were isolated from cows, sheep and pigs during outbreaks occurred in Buenos Aires, Entre Ríos, Santa Fe and La Pampa in the past fifty years. All of the field strains presented plasmids pXO1 and pXO2, except for a strain isolated from pig that only presented plasmid pXO2. All the strains and the vaccine strain belonged to the same VNTR variant that was defined by sequencing the vrrA locus from three of the isolates and the strain 34F2. These sequences were completely identical and corresponded to the variant VNTR4. Thus, the fourteen Argentine B. anthracis strains studied showed great uniformity at molecular level even though they had been isolated from different mammal species within a wide time period and covering an extensive geographical area.

Key words: Bacillus anthracis; Typing; Variable-number tandem repeat; VNTR; vrrA gene; PCR

Bacillus anthracis es el agente causal del ántrax o carbunclo. Los animales se infectan principalmente por contacto con esporas presentes en el suelo, donde éstas pueden sobrevivir por largos períodos. El hombre se infecta accidentalmente por contacto con animales enfermos o sus desechos. Si bien puede ser controlado por vacunación, el carbunclo continúa siendo endémico en algunas áreas del mundo, como en nuestro país. Las cepas virulentas de B. anthracis producen toxinas y son capsuladas. Estas cepas poseen dos plásmidos relacionados con la virulencia, el plásmido pXO1, que codifica las toxinas, y el plásmido pXO2, que codifica la cápsula.
A nivel molecular, B. anthracis es una de las bacterias más monomórficas que se conocen y hasta la fecha los estudios epidemiológicos de este microorganismo se han visto limitados por la escasa disponibilidad de marcadores moleculares para distinguir los diferentes aislamientos o cepas. Los dos plásmidos antes mencionados son necesarios para la virulencia, por lo tanto su presencia puede servir como una indicación de la patogenicidad. Sin embargo, dado que la gran mayoría de los aislamientos contiene ambos plásmidos, su sola presencia (o ausencia) no puede utilizarse para categorizarlos.
El gen vrrA, descrito por Andersen et al. (1), contiene una repetición en tándem de número variable (variablenumber tandem repeat, VNTR) con un polimorfismo que involucra cinco variantes, las cuales difieren en el número de copias (dos a seis) de una repetición que posee doce pares de bases (pb) (4). Mediante análisis por PCR (reacción en cadena de la polimerasa) se pueden distinguir los cinco tipos, que se han denominado VNTR2, VNTR3, VNTR4, VNTR5 y VNTR6. Así, es posible clasificar los distintos aislamientos de B. anthracis teniendo en cuenta la variante de VNTR presente. Esta característica varía con el origen geográfico de los aislamientos, aunque mundialmente los tipos más comunes son el VNTR4 y el VNTR3 (4).
El objetivo de este trabajo ha sido caracterizar molecularmente una colección de catorce cepas de campo de B. anthracis aisladas de distintos animales en la Argentina y la cepa vacunal Sterne 34F2, sobre la base del estudio del locus vrrA y de la presencia o ausencia de los plásmidos de virulencia.
Las cepas de campo analizadas fueron aisladas principalmente de bovinos (n=11), pero también de porcinos (n=1) y ovinos (n=2), durante brotes ocurridos en nuestro país en las provincias de Buenos Aires, Entre Ríos, Santa Fe y La Pampa, a partir del año 1956 (Tabla 1). Todas las cepas fueron crecidas en placas de agar triptosa, con incubación a 37 °C. El templado de ADN de cada cepa se obtuvo calentando a 98 °C durante 15 minutos una colonia resuspendida en 50 ml de agua bidestilada. Después de una centrifugación a 14.000 x g durante 30 segundos, se colectó el sobrenadante y se conservó a -20°C hasta su utilización.

Tabla 1. Cepas de campo de Bacillus anthracis utilizadas en este estudio.

La presencia de los dos plásmidos de virulencia se determinó por PCR en dos reacciones realizadas en paralelo, utilizando los oligonucleótidos PA5 (5' TCCTAACAC TAACGAAGTCG) y PA8 (5' GAGGTAGAAGGATA TACGGT), que son específicos para el gen pagA, el cual codifica al antígeno protector en el plásmido pXO1; y los oligonucleótidos 1234 (5´CTGAGCCATTAATCGATATG) y 1301 (5' TCCCACTTACGTAATCTGAG), que son específicos para el gen capA del operón cap y que codifica para la biosíntesis de la cápsula en el plásmido pXO2. Estos oligonucleótidos y el protocolo de PCR utilizado son los recomendados por la OIE (6). Se incluyó un control negativo, donde el templado de ADN se reemplazó por agua, y un control positivo para el plásmido pXO1, donde el templado de ADN se obtuvo a partir de la cepa Sterne 34F2. Los productos de amplificación se visualizaron en geles de agarosa 1,6% con bromuro de etidio, en buffer TAE 1x (40 mM Trisacetato, 1 mM EDTA). Los geles se observaron bajo luz UV y se fotografiaron con filtro amarillo.
El número de copias de la unidad repetitiva del gen vrrA se determinó por PCR utilizando los oligonucleótidos EWA1 (5' TATGGTTGGTATTGCTG) y EWA2 (5' ATGGTTCCGCCTTATCG) previamente descritos (1). El tamaño de los productos de amplificación se estimó por comparación con un CincuentaMarker (Biodynamics) en geles de agarosa metaphor 4% (Cambrex) con bromuro de etidio, en buffer TBE 0,5x (45 mM Tris-borato, 1 mM EDTA). La electroforesis fue llevada a cabo a 80 V durante 150 minutos.
Para amplificar un fragmento de ADN de aproximadamente 400 pares de bases, que contiene la zona repetitiva del gen vrrA, se trabajó con la cepa vacunal Sterne 34F2 y con tres de las cepas de campo estudiadas, elegidas por su antigüedad (cepa 1956), por su elevada patogenicidad (cepa Zárate) o al azar (cepa Grande). En este caso se utilizaron los oligonucleótidos GPR-4 (5' ACAACTACCACC GATGGC) y GPR-5 (5' TTATTTATCATATTAGTTGGA TTCG), descritos por Jackson et al. (4). Los amplicones fueron purificados utilizando el kit Wizard SV gel and PCR cleanup system (Promega), cuantificados y secuenciados por Macrogen en Corea, utilizando los oligonucleótidos GPR-4 y GPR-5 y el secuenciador automático Applied Biosystems 3730xl. Las secuencias obtenidas fueron comparadas con secuencias depositadas en el banco de datos Genbank utilizando el programa FASTA (7), y finalmente alineadas con la secuencia parcial publicada del gen vrrA de la cepa Ames (Genbank U63966) utilizando el programa ClustalW, Versión 1.82 (2).
El análisis por PCR de trece de los aislamientos de campo de B. anthracis demostró la presencia del plásmido pXO1 cuando la amplificación fue específica para el gen pagA. El tamaño de los productos de amplificación fue de 596 pares de bases, de acuerdo con lo teóricamente esperado (Figura 1, calles a). La única excepción fue la cepa aislada de cerdo, que no mostró ningún fragmento de amplificación, como puede observarse en la Figura 1, calle 8a. Cuando la amplificación fue realizada utilizando los oligonucleótidos específicos para el gen capA, se obtuvo para los catorce aislamientos un fragmento de 846 pares de bases, lo que corroboró la presencia del plásmido pXO2 (Figura 1, calles b).


Figura 1. Geles de agarosa de los productos de amplificación de los genes pagA (plásmido pXO1) y capA (plásmido pXO2) de algunas de las cepas de campo de B. anthracis analizadas y de la cepa vacunal Sterne 34F2. Para cada cepa, en la primera calle (a) se muestra el amplicón obtenido utilizando oligonucleótidos específicos para el gen pagA y en la segunda calle (b) el amplicón obtenido con oligonucleótidos específicos para el gen capA. PM, marcador de peso molecular (1 kb DNA Ladder, Promega).

El análisis del gen vrrA demostró que los catorce aislamientos y la cepa Sterne 34F2 pertenecían a la misma variante de VNTR, tentativamente VNTR4 (Figura 2). La unidad repetitiva en el gen vrrA tiene apenas doce pares de bases, por lo tanto la diferencia de tamaño de los amplicones para las distintas variantes es muy pequeña. Si bien en las corridas electroforéticas utilizamos geles de agarosa de alta resolución, decidimos confirmar nuestra presunción secuenciando la región que contiene la zona repetitiva de este gen, para algunas de las cepas estudiadas. Para esto amplificamos un fragmento del gen de aproximadamente 400 pares de bases de la cepa vacunal Sterne 34F2 y de tres aislamientos de campo espaciados temporalmente: la cepa 1956, aislada en el año 1956, la cepa Zárate, aislada en 1982 y la cepa Grande, aislada en 2002, todas de origen bovino. Los amplicones se secuenciaron y sus secuencias se compararon con secuencias publicadas. La figura 3 muestra el alineamiento de las secuencias parciales del gen vrrA obtenidas para la cepa Sterne 34F2 y para las cepas 1956, Zárate y Grande con la secuencia publicada del gen vrrA de la cepa Ames, que presenta un VNTR4 (4). El alineamiento múltiple de las secuencias mostró en todos los casos cuatro repeticiones idénticas de doce pares de bases, hecho que confirma la variante VNTR4 para la cepa Sterne 34F2 y para los tres aislamientos y, a su vez, para todos los demás aislamientos estudiados. En concordancia con publicaciones previas (4), esta variante no fue específica de un huésped determinado.


Figura 2. Geles de agarosa de alta resolución de los productos de amplificación del gen vrrA de algunas de las cepas de campo analizadas y de la cepa Sterne 34F2. PM, marcador de peso molecular (CincuentaMarker, Biodynamics).


Figura 3. Alineamiento múltiple de secuencias parciales del gen vrrA. Las secuencias de las cepas Sterne 34F2, 1956, Zárate y Grande fueron alineadas con la secuencia de la cepa Ames (GenBank U63966). Los asteriscos indican identidad; en color se indican las cuatro repeticiones.

Se ha postulado que la distribución geográfica de las distintas variantes de VNTR sugiere el origen de los distintos brotes de ántrax (3, 4). Estudios previos de tres cepas argentinas habían demostrado la presencia en nuestro país de los tipos VNTR2 (n=1), VNTR4 (n=1) y VNTR5 (n=1) (4, 5). A través de este estudio nosotros verificamos la presencia de una única variante, a pesar de que se analizaron catorce aislamientos provenientes de una amplia zona de nuestro país, obtenidos a lo largo de un extenso período de tiempo.

Agradecimientos: Al Dr. H. Grande y al Instituto Rosenbusch por las cepas Grande y 1956, respectivamente.

BIBLIOGRAFÍA

1. Andersen GL, Simchock JM, Wilson KH. Identification of a region of genetic variability among Bacillus anthracis strains and related species. J Bacteriol 1996; 178: 377-84.
2. Chenna R, Sugawara H, Koike T, Lopez R, Gibson TJ, Higgins DG et al. Multiple sequence alignment with the Clustal series of programs. Nucleic Acids Res 2003; 31: 3497-500.
3. Fasanella A, Van Ert M, Altamura SA, Garofolo G, Buonavoglia C, Leori G et al. Molecular diversity of Bacillus anthracis in Italy. J Clin Microbiol 2005; 43: 3398-401.
4. Jackson PJ, Walthers EA, Kalif AS, Richmond KL, Adair DM, Hill KK et al. Characterization of the variable-number tandem repeats in vrrA from different Bacillus anthracis isolates. Appl Environ Microbiol 1997; 63: 1400-5.
5. Keim P, Price LB, Klevytska AM, Smith KL, Schupp JM, Okinaka R et al. Multiple-locus variable-number tandem repeat analysis reveals genetic relationships within Bacillus anthracis. J Bacteriol 2000; 182: 2928-36.
6. Office International des Epizootes. Anthrax. En: Manual of standards for diagnostic tests and vaccines. 2000.
7. Pearson WR. Rapid and sensitive sequence comparison with FASTP and FASTA. Methods Enzymol 1990; 183: 63-98.         [ Links ]         [ Links ]         [ Links ]         [ Links ]         [ Links ]         [ Links ]         [ Links ]

Recibido: 05/06/06
Aceptado
: 26/03/07