SciELO - Scientific Electronic Library Online

 
vol.39 número3Evaluación de la técnica de MSP-PCR para la caracterización molecular de aislamientos de Rhodotorula mucilaginosa provenientes de la Patagonia noroccidentalPseudomonas aeruginosa: una bacteria con personalidades múltiples índice de autoresíndice de materiabúsqueda de artículos
Home Pagelista alfabética de revistas  

Servicios Personalizados

Articulo

Indicadores

  • No hay articulos citadosCitado por SciELO

Links relacionados

  • En proceso de indezaciónCitado por Google
  • No hay articulos similaresSimilares en SciELO
  • En proceso de indezaciónSimilares en Google

Bookmark


Revista argentina de microbiología

versión On-line ISSN 1851-7617

Rev. argent. microbiol. v.39 n.3 Ciudad Autónoma de Buenos Aires jul./sep. 2007

 

Diseño y construcción de vectores de transferencia para la obtención de virus vaccinia Ankara modificado (MVA) recombinantes

M. F. Ferrer1, 2, F. A. Zanetti1, 2, 3, G. Calamante1*

1 Instituto de Biotecnología, CICVyA, INTA. Casilla de correo 25 (B1712WAA) Castelar, Buenos Aires;
2 Consejo Nacional de Investigaciones Científicas y Técnicas (CONICET), Rivadavia 1917 (C1033AAJ) Ciudad de Buenos Aires;
3 Agencia Nacional de Promoción Científica y Tecnológica (ANPCyT), Córdoba 831 Piso 1 (C1054AAH) Ciudad de Buenos Aires.

* Correspondencia. E-mail: gcalamante@cnia.inta.gov.ar

RESUMEN

El virus vaccinia Ankara modificado (MVA) constituye un buen candidato para el desarrollo de vectores virales de expresión no replicativos porque no replica en la mayoría de las células de mamíferos. Para la producción de MVA recombinantes es fundamental disponer de vectores de transferencia que, por recombinación homóloga con el genoma viral, permitan introducir los genes de interés en regiones no esenciales para la replicación in vitro. En este trabajo se diseñaron y obtuvieron los vectores de transferencia denominados VT-MHA y VT-MTK que portan las regiones correspondientes a las posiciones 1-303 y 608-948 del gen MVA165R y 1-244 y 325-534 del gen MVA086R, respectivamente, las que flanquean un sitio de clonado múltiple para la inserción de los genes foráneos. En dichos vectores se clonaron los casetes para la expresión de los genes lac Z o uid A, y la actividad de las enzimas marcadoras b-galactosidasa y b-glucuronidasa se confirmó in situ. Además, utilizando el vector denominado VT-MTK-GUS, se obtuvieron y aislaron MVA recombinantes puros que portan y expresan el gen uid A. Los resultados obtenidos constituyen las herramientas básicas para establecer la metodología de obtención de MVA recombinantes, con el propósito de desarrollar localmente vectores virales no replicativos candidatos a vacunas.

Palabras clave: Poxvirus; MVA; Vector viral no replicativo

ABSTRACT

Design and construction of transfer vectors in order to obtain recombinant modified vaccinia virus Ankara (MVA). Modified Vaccinia virus Ankara (MVA) constitutes a good candidate for the development of non-replicative expression viral vectors because it does not replicate in most of mammalian cells. It is essential, for the production of recombinant MVA, the availability of transfer vectors which allow the introduction of desired genes into non-essential regions for in vitro viral replication, by homologous recombination with the viral genome. In the present work, the transfer vectors named VT-MHA and VT-MTK were designed and obtained. They carried genomic regions corresponding to 1- 303 and 608-948 positions of the MVA165R gene and 1-244 and 325-534 of the MVA086R gene, respectively, which flank a multiple cloning site for the insertion of foreign genes. In these vectors, the cassettes for the expression of lac Z or uid A genes were cloned, and the activity of the marker enzymes b-galactosidase and b-glucuronidase was confirmed in situ. Furthermore, the vector named VT-MTK-GUS was used to obtain and isolate pure recombinant MVA, which carried and expressed the uid A gene. The results herein constitute the basic tools for establishing the methodology to obtain recombinant MVA with the purpose of locally developing non-replicative viral vectors as candidate vaccines.

Key words: Poxvirus; MVA; Non-replicative viral vector

Los poxvirus se han utilizado eficientemente como vectores para la expresión in vivo de genes foráneos y para la construcción de vacunas contra enfermedades infecciosas (10-12, 14). En particular, el virus vaccinia Ankara modificado (MVA), que no replica en la mayoría de las células de mamíferos, es uno de los candidatos para ser utilizado en el desarrollo de vacunas por ser un vector viral vivo no replicativo con probada seguridad y por la versatilidad que presenta para la expresión de proteínas heterólogas (4-6). Debido al gran tamaño de su genoma, la generación de MVA recombinantes se realiza por recombinación homóloga entre el genoma viral y un ADN plasmídico que porta el gen de interés (bajo regulación de un promotor temprano del virus vaccinia) flanqueado por regiones no esenciales para la replicación viral in vitro.
En este trabajo se presenta el diseño y la construcción de los vectores de transferencia para obtener MVA recombinantes utilizando como sitios blanco de inserción los genes MVA086R y MVA165R, que codifican para las proteínas timidina quinasa (TK) y hemoaglutinina (HA), respectivamente (acceso GenBank U94848). Estos genes son no esenciales para la replicación de MVA in vitro y han sido exitosamente usados en el desarrollo de vectores virales (1, 13). Teniendo en cuenta que estos vectores no son de uso público ni están desarrollados en nuestro país, su obtención nos permitirá disponer libremente de una herramienta molecular útil para evaluar vacunas de nueva generación basadas en vectores virales no replicativos.
El ADN recombinante se obtuvo aplicando las técnicas estándares. Las regiones genómicas virales se amplificaron por PCR utilizando como templado ADN total purificado de células de riñón de hámster bebé (BHK-21) infectadas con MVA. Se diseñaron cuatro oligonucleótidos específicos para amplificar y clonar las secuencias genómicas que codifican para las proteínas hemoaglutinina y timidina quinasa, respectivamente. En cada caso se amplificaron dos regiones denominadas izquierda y derecha, que corresponden a las posiciones 1-303 y 608-948 del gen MVA165R (ha) y 1-244 y 325-534 del gen MVA086R (tk).
Para la construcción del vector VT-MHA se amplificó la región derecha del gen ha utilizando los oligonucleótidos HA3 (5´ GCAAGCTTCAACAGACGAGAC TCCGG) y HA4 (5´ GGGGTACCAGAATATTGCCACGG CCG) y se clonó en el plásmido pGem-T Easy (Promega). Posteriormente, el inserto se escindió por restricción con las enzimas Hind III y Kpn I (cuyas secuencias de reconocimiento se encontraban presentes en los oligonucleótidos HA3 y HA4, respectivamente) y se clonó direccionalmente en el plásmido pBlueScript previamente digerido con las mismas enzimas, para obtener el clon denominado pBS-HAder.
La región izquierda del gen ha se amplificó utilizando los oligonucleótidos HA1 (5´ TCCCCGCGGATGACAC GATTACCAATA) y HA2 (5´ TCCCCGCGGATAAGTACC GGCATCTCT) y se clonó en el plásmido pGem-T Easy. Luego de confirmar su identidad por secuenciación, se escindió el inserto por restricción con la enzima Sac II y se lo subclonó en la construcción pBS-HAder. Debido a la naturaleza no direccionada del clonado, la correcta orientación del fragmento izquierdo respecto del derecho se evaluó mediante PCR utilizando los oligonucleótidos HA1 y HA4. En tres de los cuatro clones obtenidos se observó la amplificación de un fragmento del tamaño esperado (aprox. 670 pb), lo que confirmó la construcción del vector de transferencia VT-MHA.
Siguiendo una estrategia de clonado similar, pero con oligonucleótidos específicos para la amplificación del gen tk, se obtuvo el vector VT-MTK. Para las amplificaciones por PCR de los fragmentos derecho e izquierdo se utilizaron los pares de oligonucleótidos TK3 (5´ GCAAGCTTT CGATGGGACATTTCAAC) - TK4 (5´ GGGGTACCTT ATGAGCCGACGTAACA) y TK1 (5´ TCCCCGCGGTGA ACGGCGGACATATTC) - TK2 (5´ TCCCCGCGGACCTA TCACGGAGAAATC), respectivamente. Luego de los sucesivos subclonados se obtuvo el vector de transferencia VT-MTK; la correcta orientación de sus fragmentos izquierdo y derecho se confirmó por secuenciación y por amplificación por PCR con los oligonucleótidos TK1 y TK4, que originó un producto de 550 pb aproximadamente.
Dada la estrategia de clonado aplicada, los fragmentos izquierdo y derecho de VT-MHA y VT-MTK flanquean un sitio de clonado múltiple que posee secuencias únicas de reconocimiento para varias enzimas de restricción (Not I, Xba I, Spe I, Bam HI, Sma I, Pst I, Eco RI, Eco RV y Hind III).
Con el propósito de establecer las condiciones para la obtención de MVA recombinantes, los casetes para la expresión de genes marcadores se subclonaron en los vectores de transferencia construidos. Dichos casetes portaban los genes que codifican para las enzimas β-glucuronidasa (GUS) o β-galactosidasa (GAL) bacterianas, bajo la regulación del promotor temprano del gen H6 del virus vaccinia. Este promotor fue elegido para que la expresión de los genes marcadores ocurriera solamente durante la etapa temprana de la replicación viral y para que su secuencia nucleotídica fuera diferente de la del promotor sintético E/L temprano/tardío, el que dirige la expresión de los genes que codifican para las proteínas inmunogénicas; de este modo disminuye la posibilidad de recombinación homóloga intramolecular, con la consiguiente eliminación de los genes de interés.
El casete del gen marcador fue escindido por restricción con la enzima Not I a partir de las construcciones pH6-GUS o pH6-GAL, obtenidas previamente en nuestro laboratorio. Los extremos de los insertos liberados se rellenaron por tratamiento con la enzima Klenow y se ligaron, respectivamente, con los vectores de transferencia VT-MTK o VT-MHA, previamente digeridos con la enzima Eco RV y tratados con fosfatasa alcalina. Los plásmidos recombinantes se analizaron por restricción y se confirmó la construcción de los vectores de transferencia VT-MTK-GUS y VT-MHA-GAL (Figura 1).


Figura 1. Esquema de los vectores de transferencia VT-MTKGUS y VT-MHA-GAL.
La expresión de los genes marcadores uid A (GUS) y lac Z (GAL) se encuentra regulada por el promotor temprano del gen H6 (pH6) del virus vaccinia. Las regiones genómicas de MVA que codifican para los genes MVA086R (tk) y MVA165R (ha) flanquean a los casetes de expresión de los genes marcadores en las posiciones 1-244 (TKi); 325-534 (TKd); 1-303 (HAi) y 608-948 (HAd). Las flechas indican la posición de los oligonucleótidos utilizados para amplificar por PCR los flancos izquierdo y derecho de cada vector. B: BamHI; E: EcoRI; H: Hind III; K: Kpn I, P: Pst I; Sc: Sac II; Sm: Sma I; Sp: Spe I; X: Xba I.

Primeramente, la expresión de los genes marcadores (uid A y lac Z) se corroboró mediante ensayos de infección y transfección transitoria en células BHK-21. Para ello, las células se infectaron con un stock de MVA y a las 4 h posinfección se agregó una mezcla de ADN del VT/lipofectamina (Invitrogen). Luego de incubar 48 h a 37 °C en atmósfera de 5% de CO2, las células se fijaron (2% formaldehído, 0,05% glutaraldehído en PBS) y se agregó solución de revelado (ferrocianuro de potasio 5 mM, ferrocianato de potasio 5 mM, cloruro de magnesio 2 mM en PBS) con 1 mg/ml de los sustratos X-gluc (5- bromo-4-cloro-3-indolil-β-D-glucurónido) o X-gal (5- bromo-4-cloro-3-indolil-β-D-galactósido). La observación microscópica de células azules a las 16 h del revelado puso en evidencia la actividad enzimática sólo en los cultivos infectados y transfectados con VT-MTK-GUS y VT-MHA-GAL.
Posteriormente, con el prop ósito de obtener MVA recombinantes, el VT-MTK-GUS se transfectó en cultivos primarios de fibroblastos de embrión de pollo infec tados con MVA. La transfección se realizó a las 4 h posinfección utilizando lipofectina (Invitrogen). A los 5 días de la transfección, cuando se observó efecto citopático generalizado, se cosecharon las células y el sobrenadante, que se sometieron a 3 ciclos de congelado (-70 °C)/ descongelado (37 °C) y se realizó el rastreo de los virus recombinantes. Para ello, monocapas de fibroblastos de embrión de pollo crecidos en placas de 60 mm de diámetro se infectaron con diluciones seriadas al décimo del stock viral proveniente de la infección/transfección y se cubrieron con medio de placa semisólido (MEM-D suplementado con 2% de suero fetal bovino Natocor, 100 unidades/ ml de penicilina, 100 mg/ml de estreptomicina, 0,25 mg/ml de anfotericina B, Hepes 25 mM y 0,7% de agarosa de tipo VII de bajo punto de fusión, Sigma). Cuando se observó la formación de placas de lisis, se agregó una segunda capa de medio agarizado con 0,2 mg/ml de XGluc, sustrato de la enzima GUS. Los virus presentes en las placas de lisis azules fueron cosechados y sometidos a nuevas rondas de selección por placa en presencia de X-Gluc. Este rastreo se realizó cinco veces, hasta la obtención de un stock homogéneo que presentó el 100% de placas de lisis azules.
Luego, este stock viral se amplificó y se aisló el ADN total presente en las células infectadas, con el propósito de evaluar la pureza del stock viral recombinante mediante una reacción de PCR utilizando tres oligonucleótidos específicos que, sobre la base de los productos amplificados, permite diferenciar la presencia de genomas recombinantes y no recombinantes. En la Figura 2A se muestra un esquema del genoma recombinante MVA-GUS y del no recombinante MVA, la ubicación de los oligonucleótidos usados en la reacción de PCR diferencial y los productos esperados en cada caso. La reacción se realizó en presencia de los tres oligonucleótidos, uno de ellos (TK1) al doble de concentración. El tiempo de elongación se ajustó de manera tal que en la amplificación del genoma recombinante estuvo favorecida la obtención del producto más corto, y no fue suficiente para la amplificación del producto de mayor tamaño (en este caso, por los pares de oligonucleótidos TK1-GUSR o TK1-TK4, respectivamente). En la Figura 2B se observa la amplificación específica de los fragmentos de 550 o 1450 pb sobre el genoma de MVA o sobre el ADN plasmídico del VT-MTK-GUS, respectivamente. Estos productos no se observaron en las calles correspondientes a los controles negativos (ADN de fibroblastos de embrión de pollo no infectados y sin ADN). Además, en los stocks MVA-GUS N° 63 y 64, que presentaban 100% de placas de lisis azules, no se detectaron los productos de amplificación del genoma no recombinante, hecho que confirmó su pureza. En cambio, el virus MVA-GUS N° 56, que presentaba 100% de placas de lisis azules, no constituye un stock puro porque se observó la banda de amplificación del genoma no recombinante.


Figura 2. Determinación de la pureza de los virus recombinantes MVA-GUS mediante PCR diferencial. A. Esquema de los genomas recombinantes y no recombinantes, ubicación de los oligonucleótidos TK1, TK4 y GUSR (5´ CCCGCTTCGAAACCAATGCC) utilizados en la amplificación por PCR. Las líneas indican el tamaño de los fragmentos de amplificación esperados.
B. El tamaño de los productos de amplificación por PCR se confirmó por electroforesis en geles de agarosa 1% y tinción con bromuro de etidio. NI: células no infectadas; V: MVA; 56, 63 y 64: MVA-GUS; M: 1 Kb DNA Plus (Invitrogen); -: sin ADN; VT: VT-MTK-GUS. El perfil de ciclado fue: 94 °C 5 min; 30 ciclos (94 °C 1 min; 50 °C 1 min; 72 °C 2 min); 72 °C 10 min.

En este trabajo se obtuvieron las herramientas iniciales para la obtenci ón de MVA recombinantes, ya que se diseñaron y construyeron los vectores de transferencia que permitirán la inserción de genes foráneos interrumpiendo los genes virales que codifican para las proteínas timidina quinasa (TK) y hemoaglutinina (HA). Además, utilizando el VT-MTK-GUS, que permite la recombinación homóloga con la región genómica del gen tk, se obtuvieron MVA recombinantes estables que portan y expresan el gen uid A bajo regulación del promotor H6 del virus vaccinia.
Durante los últimos años se presentaron numerosos reportes que indican que los vectores virales basados en MVA recombinantes son buenos candidatos para el desarrollo de vacunas en el área de salud humana (2, 6-9), sin embargo no existen muchas publicaciones sobre su utilización en el área de sanidad animal (3, 15). Es por ello que la disponibilidad de estas herramientas moleculares en nuestro laboratorio, así como también la implementación de la metodología de obtención, selección y caracterización de MVA recombinantes, nos permitirán diseñar y obtener vectores virales no replicativos que expresen proteínas inmunogénicas, con el propósito de desarrollar vacunas de nueva generación (mono y bivalentes) para la prevención de enfermedades infecciosas de bovinos (fiebre aftosa, herpesvirus y diarrea viral bovina) y de aves (enfermedades de Gumboro y Marek).

Agradecimientos: Los autores agradecen a la Agencia Nacional de Promoción Científica y Tecnológica por la financiación recibida (PICT 2002 08-11195), a M. J. Mónaco y V. Calderón por su asistencia técnica, al Dr. O. Zabal y su equipo por la realización de los cultivos primarios de embrión de pollo.

BIBLIOGRAFÍA

1. Antoine G, Scheiflinger F, Holzer G, Langmann T, Falkner FG, Dorner F. Characterization of the vaccinia MVA hemagglutinin gene locus and its evaluation as an insertion site for foreign genes. Gene 1996; 177: 43-6.
2. Bejon P, Peshu N, Gilbert SC, Lowe BS, Molyneux CS, Forsdyke J, et al. Safety profile of the viral vectors of attenuated fowlpox strain FP9 and modified vaccinia virus Ankara recombinant for either of 2 preerythrocytic malaria antigens, ME-TRAP or the circumsporozoite protein, in children and adults in Kenya. Clin Infect Dis 2006; 42: 1102-10.
3. Breathnach CC, Clark HJ, Clark RC, Olsen CW, Townsend HG, Lunn DP. Immunization with recombinant modified vaccinia Ankara (rMVA) constructs encoding the HA or NP gene protects ponies from equine influenza virus challenge. Vaccine 2006; 24: 1180-90.
4. Carroll MW, Moss B. Host range and cytopathogenicity of the highly attenuated MVA strain of vaccinia virus: propagation and generation of recombinant viruses in a nonhuman mammalian cell line. Virology 1997; 238: 198-211.
5. Drexler I, Heller K, Wahren B, Erfle V, Sutter G. Highly attenuated modified vaccinia virus Ankara replicates in baby hamster kidney cells, a potential host for virus propagation, but not in various human transformed and primary cells. J Gen Virol 1998; 79: 347-52.
6. Gherardi MM, Esteban M. Recombinant poxviruses as mucosal vaccine vectors. J Gen Virol 2005; 86: 2925-36.
7. Gherardi MM, Perez-Jimenez E, Najera JL, Esteban M. Induction of HIV immunity in the genital tract after intranasal delivery of a MVA vector: enhanced immunogenicity after DNA prime-modified vaccinia virus Ankara boost immunization schedule. J Immunol 2004; 172: 6209-20.
8. Horig H, Kaufman HL. Local delivery of poxvirus vaccines for melanoma. Semin Cancer Biol 2003; 13: 417-22.
9. McShane H, Pathan AA, Sander CR, Keating SM, Gilbert SC, Huygen K, et al. Recombinant modified vaccinia virus Ankara expressing antigen 85A boosts BCG-primed and naturally acquired antimycobacterial immunity in humans. Nat Med 2004; 10: 1240-4. Erratum in: Nat Med 2004; 10: 1397.
10. Moss B. Genetically engineered poxviruses for recombinant gene expression, vaccination and safety. Proc Natl Acad Sci USA 1996; 93: 11341-48.
11. Paoletti E, Lipinskas B, Samsonoff C, Mercer S, Panicali D. Construction of live vaccines using genetically engineered poxviruses: biological activity of vaccinia virus recombinants expressing the hepatitis B virus surface antigen and the herpes simplex virus glycoprotein D. Proc Natl Acad Sci USA 1984; 81: 193-7.
12. Pastoret PP, Vanderplasschen A. Poxviruses as vaccine vectors. Com Immunol Micobiol and Infect Dis 2003; 26: 343-55.
13. Scheiflinger F, Falkner FG, Dorner F. Evaluation of the thymidine kinase (tk) locus as an insertion site in the highly attenuated vaccinia MVA strain. Arch Virol 1996; 141: 663-9.
14. Taylor J, Meignier B, Tartaglia J, Languet B, VanderHoeven J, Franchini G, et al. Biological and immunogenic properties of a canarypox-rabies recombinant, ALVAC-RG (vCP65) in non-avian species. Vaccine 1995; 13: 539-49.
15. Vordermeier HM, Rhodes SG, Dean G, Goonetilleke N, Huygen K, Hill AV, et al. Cellular immune responses induced in cattle by heterologous prime-boost vaccination using recombinant viruses and bacille Calmette-Guerin. Immunology 2004; 112: 461-70.         [ Links ]         [ Links ]         [ Links ]         [ Links ]         [ Links ]         [ Links ]         [ Links ]         [ Links ]         [ Links ]         [ Links ]         [ Links ]         [ Links ]         [ Links ]         [ Links ]         [ Links ]

Recibido: 26/12/2006
Aceptado: 17/07/2007