SciELO - Scientific Electronic Library Online

 
vol.39 issue4Antimicrobial resistance of Escherichia coli isolated from pigs in ArgentinaSimplified prediction of Staphylococcus aureus growth in a cooked meat product exposed to changing environmental temperatures in warm climates author indexsubject indexarticles search
Home Pagealphabetic serial listing  

Services on Demand

Article

Indicators

  • Have no cited articlesCited by SciELO

Related links

Share


Revista argentina de microbiología

On-line version ISSN 1851-7617

Rev. argent. microbiol. vol.39 no.4 Ciudad Autónoma de Buenos Aires Oct./Dec. 2007

 

Identificación rápida y sensibilidad a toxinas killer de levaduras aisladas de micosis no sistémicas

M. P. Sangorrín1, 3, C. A. Lopes1, 2, 3, A. Rivero1, A. C. Caballero1*

1Departamento de Química, Laboratorio de Microbiología y Biotecnología, Facultad de Ingeniería, Universidad Nacional del Comahue, Buenos Aires 1400 (8300) Neuquén, Argentina;
2Departamento de Biología Aplicada, Laboratorio de Microbiología Agrícola, Facultad de Ciencias Agrarias, Universidad Nacional del Comahue. Ruta 151, Km 12,5 Cinco Saltos, Río Negro, Argentina;
3Consejo Nacional de Investigaciones Científicas y Técnicas de la República Argentina (CONICET)
*Correspondencia. E-mail: acaballe@uncoma.edu.ar

RESUMEN

La identificación rápida y segura de los agentes etiológicos y el desarrollo de nuevos antifúngicos con blancos de acción más específicos resultarán en tratamientos de las micosis más efectivos y menos lesivos. Mediante un método molecular rápido (ITS1-5.8S ADNr-ITS2 PCR-RFLP) se identificaron 53 aislamientos de levaduras provenientes de infecciones no sistémicas registradas en hospitales públicos de la ciudad de Neuquén y en un centro oftalmológico de Buenos Aires durante el año 2005. Adicionalmente y utilizando el método de inhibición del crecimiento en placa, se evaluó la sensibilidad de estas levaduras a toxinas killer producidas por levaduras indígenas de la Patagonia y por cepas de referencia. Ocho especies de levaduras fueron identificadas entre los aislamientos clínicos: Candida albicans (52%) , Candida parapsilosis (17%) , Candida tropicalis (10%) , Candida krusei (5%) , Candida glabrata (4%) , Candida guilliermondii (4%) , Kluyveromyces lactis (4%) y Saccharomyces cerevisiae (4%) . El 69% de los aislamientos de la especie mayoritaria, C. albicans, se relacionó con infecciones vaginales. Por otra parte, el 61% de las levaduras provenientes de infecciones oculares correspondió a la especie C. parapsilosis. En las condiciones de ensayo, las toxinas producidas por las levaduras killer indígenas DVMais5 y HCMeiss5 pertenecientes a las especies Pichia anomala y P. kluyveri, respectivamente, exhibieron el mayor espectro de acción sobre las levaduras aisladas de materiales clínicos.

Palabras claves: Identificación; Levaduras; Micosis; ITS-RFLP; Toxinas killer

ABSTRACT

Rapid identification and susceptibility to killer toxins of yeasts isolated from non-systemic mycoses. The use of quick and reliable yeast identification methods, as well as the development of new antifungal agents with more specific targets, will enable a more efficient treatment of mycoses. In the present work, a total of 53 clinical isolates obtained from non-systemic infections in Neuquén Hospitals and an ophthalmologic clinic in Buenos Aires during 2005, were identified by means of a rapid molecular method (ITS1-5.8S ADNr-ITS2 PCR-RFLP). Additionally, the killer susceptibility of the isolates was tested against reference and indigenous killer yeasts on plate tests. Eight yeast species were identified among the clinical isolates: Candida albicans (52%), Candida parapsilosis (17%), Candida tropicalis (10%), Candida krusei (5%), Candida glabrata (4%) , Candida guilliermondii (4%) , Kluyveromyces lactis (4%) and Saccharomyces cerevisiae (4%) . Sixty-nine percent of the isolates corresponding to the predominant species ( C. albicans) were related to vaginal infections. On the other hand, 61% of the yeasts associated with ocular infections were identified as C. parapsilosis. Two indigenous killer isolates DVMais5 and HCMeiss5, belonging to Pichia anomala and P. kluyveri respectively, exhibited the broadest killer spectrum against clinical isolates.

Key words: Yeast identification; Yeast; Mycoses; ITS-RFLP; Killer toxins

INTRODUCCIÓN

El potencial patogénico de las levaduras varía considerablemente entre sus diferentes géneros, y se considera a Candida como el más relevante. Este género abarca más de 160 especies, 18 de las cuales se han descrito como causantes de manifestaciones clínicas (18, 26). Dentro de éstas, Candida albicans es la especie observada con mayor frecuencia (70% de los casos), principalmente en infecciones de tipo superficial como vaginitis, onicomicosis y dermatomicosis (9, 28), seguida por Candida tropicalis y Candida parapsilosis (14, 15). Por otra parte y aun cuando las infecciones fúngicas conjuntivales se han considerado cuadros clínicos poco frecuentes, en los últimos años el uso de tecnologías láser para la corrección de problemas de la visión y el tipo de tratamiento previo que ellas conllevan han aumentado de manera significativa la frecuencia de aparición de infecciones oftalmológicas causadas por levaduras. Recientemente se han comunicado casos clínicos de conjuntivitis y, sobre todo, de queratitis causados por C. albicans y C. parapsilosis (16).
Los fármacos disponibles en la actualidad para el tratamiento de las micosis son escasos y poco selectivos, con blancos de acción involucrados en procesos metabólicos comunes a todas las células eucariontes (7, 17). Este hecho, y las consecuencias clínicas del desarrollo de mecanismos de resistencia por parte de ciertas especies de levaduras (21, 26), generan la necesidad de buscar nuevos compuestos que presenten ventajas comparativas apreciables frente a los existentes en el tratamiento de las micosis humanas.
En este contexto, los constituyentes de la pared celular, ausente en células de mamíferos, emergen como sitios de acción atractivos para el desarrollo de antimicóticos más selectivos (11). La búsqueda o el diseño de nuevos antimicóticos se ha orientado entonces hacia moléculas que interfieren en la síntesis de los constituyentes de la pared celular de hongos o que requieren de receptores específicos como un paso obligado para ejercer su acción tóxica. Dentro de este último grupo aparecen las toxinas killer producidas por levaduras (31). Estas toxinas, de naturaleza proteica y con actividad demostrada contra un gran número de patógenos humanos, tanto de origen fúngico como bacteriano (2, 3, 12), son producidas por distintas especies de levaduras procedentes de los ambientes más diversos (1, 23).
Se han caracterizado diferentes tipos de toxinas, las que se diferencian por su inmunidad cruzada y por sus mecanismos de acción (24, 31). No obstante e independientemente del tipo al que pertenecen y del mecanismo por el que ejercen su acción, todas las toxinas killer descritas hasta el presente necesitan unirse a receptores específicos de la pared celular de sus células blanco para ejercer su acción biológica: muerte o detención del ciclo celular de la población sensible (25).
Por otra parte, los métodos de rutina utilizados mayoritariamente en los laboratorios de análisis clínicos para la identificación de levaduras no permiten identificar de manera segura la especie responsable de la micosis (4, 5). Se emplean métodos de identificación más seguros sólo en los casos de falla terapéutica o de infecciones recidivantes o crónicas, y están limitados a laboratorios especializados o de referencia (10). El desarrollo de métodos de identificación taxonómica sencillos y seguros (6, 15), con posibilidades ciertas de ser implementados en todo tipo de laboratorios, redundará en tratamientos más adecuados y efectivos de las micosis humanas y disminuirá la probabilidad de fracasos terapéuticos, de consecuencias clínicas muchas veces graves.
Con el objetivo de responder a estos requerimientos y de identificar nuevas variantes de toxinas killer con potencial aplicación en el control de estos patógenos oportunistas, se ensayó un método molecular rápido y seguro, ampliamente utilizado en microbiología enológica, para identificar levaduras aisladas de infecciones no sistémicas. Asimismo, se evaluó la sensibilidad de estos aislamientos frente a diferentes levaduras de referencia y a levaduras indígenas de la Patagonia productoras de toxinas killer.

MATERIALES Y MÉTODOS

Levaduras asociadas a micosis no sistémicas
Los 53 aislamientos de levaduras provenientes de micosis no sistémicas utilizados en este trabajo -32 asociados a infecciones vaginales, 2 a amigdalitis, 3 a dermatitis, 3 a onixis y 13 a infecciones oculares, conjuntivitis y queratitis- fueron remitidos a nuestro laboratorio desde los Hospitales Públicos Castro Rendón y Heller, de la ciudad de Neuquén, y desde un centro privado de oftalmología de la Ciudad de Buenos Aires durante el año 2005. Sólo se aceptó un aislamiento por paciente.

Levaduras de referencia
Las cepas utilizadas como control en la identificación de las levaduras fueron: Candida albicans ATCC 90028, Candida glabrata ATCC 200918, Candida guilliermondii ATCC 46036 , Candida krusei ATCC 6258, Candida tropicalis ATCC 750, Candida parapsilosis ATCC 22019, Kluyveromyces lactis ATCC 56498 y Saccharomyces cerevisiae NCYC 18824.
Las levaduras killer de referencia fueron: S. cerevisiae YAT 679 (K1), S. cerevisiae NCYC 738 (K2), S. cerevisiae NCYC 761 (K3), C. glabrata NCYC 388 (K4), Pichia anomala NCYC 434 (K5), Kluyveromyces marxianus NCYC 587 (K6), Candida valida NCYC 327 (K7), P. anomala NCYC 435 (K8), Williopsis saturnus var. mrakii NCYC 500 (K9) y K. lactis var. drosophilarum NCYC 575 (K10). ATCC: American Type Culture Collection; NCYC: National Collection of Yeast Cultures.

Levaduras killer indígenas
Cuarenta y seis levaduras de origen enológico indígenas de la región del Comahue, norpatagonia argentina, se seleccionaron para este trabajo por su capacidad de producir toxinas killer frente a cepas de colección sensibles en ensayos previos (22). La identidad y el origen de estas levaduras killer se presentan en la Tabla 1.

Tabla 1. Identidad y origen de las levaduras killer indígenas de la región norpatagónica

Identificación de levaduras
La identificación taxonómica de las levaduras provenientes de aislamientos clínicos se realizó por análisis del polimorfismo en los tamaños de los fragmentos obtenidos por restricción con endonucleasas específicas de la región génica ITS1-ADNr 5.8SITS2, previamente amplificada por PCR (ITS1-ADNr 5.8S-ITS2 PCR/RFLP).
La amplificación de la región génica se realizó en un termociclador PTC-150 Minicycler (MJ Research Incorporated) utilizando los cebadores ITS1 (5'TCCGTAGGTGAACCTGC GG3') e ITS4 (5'TCCTCCGCTTATTGATATGC3'), previamente descritos por White y colaboradores (30). Cada colonia aislada se picó con una aguja estéril y se resuspendió en 50 µl de la mezcla de amplificación que contenía 2 µM de cada cebador; 0,1 mM de desoxinucleótidos y solución reguladora Tris-ClH 10 mM pH=9. Luego de un primer ciclo de 15 min a 95 °C, se adicionó a la mezcla 1 U de Taq ADN polimerasa. Los parámetros del termociclador se fijaron conforme con lo descrito por Esteve- Zarzoso y colaboradores (8). Los fragmentos de ADN amplificados (0,5 µg) se digirieron con las endonucleasas de restricción CfoI, HaeIII y Hinfl, de acuerdo con las especificaciones del proveedor. Los productos obtenidos de la amplificación y de la restricción de los amplificados se sometieron a electroforesis en geles de agarosa al 1,4% y 3%, respectivamente. Las electroforesis se realizaron a voltaje constante (100 V). Los geles se revelaron por tinción con bromuro de etidio (5 mg/ml) y exposición a luz ultravioleta (UV). Como marcador de peso molecular se utilizó una escala de fragmentos de 100 pb de ácido desoxirribonucleico (ADN). La identificación de las levaduras se realizó comparando los tamaños de los amplificados y de los fragmentos de restricción obtenidos experimentalmente con aquellos reportados en la base de datos www.yeast-id.com para cepas tipo de colección, algunas de las cuales se incluyeron en el trabajo con el fin de corroborar la reproducibilidad del método.
Adicionalmente, la identificación taxonómica se confirmó por métodos convencionales utilizando las pruebas y claves propuestas por Kurtzman y Fell (13), las que incluyeron: 1. morfología de la célula vegetativa y de la colonia y características de la reproducción vegetativa (medio YM agar); 2. características de la reproducción sexual (esporulación en agar acetato, McClary); 3. características del crecimiento en medio líquido (caldo YM); 4. fermentación de compuestos carbonados (medio basal: 0,45% p/v extracto de levadura y 0,75% p/v peptona, adicionado con la fuente carbonada a una concentración final del 2% p/v de C); 5. asimilación de compuestos carbonados (medio YNB agar adicionado con 1% p/v de fuente carbonada); 6. asimilación de compuestos nitrogenados (medio YCB agar adicionado con la fuente nitrogenada); 7. crecimiento en medio libre de vitaminas; y 8. crecimiento a distintas temperaturas (GPY agar: glucosa 4% p/v,; peptona 0,5% p/v; extracto de levadura 0,5% p/ v y agar 2% p/v; pH 5,5; temperaturas ensayadas 25 °C, 37 °C y 40 °C).
En todas las pruebas se utilizaron cultivos jóvenes (desarrollados en GPY líquido a 25 °C durante 16-24 h con agitación) y, excepto en la prueba de crecimiento a distintas temperaturas, todas las incubaciones se realizaron a 25 °C, con observaciones diarias durante 7 a 10 días (salvo en la prueba de morfología, que se observó a las 48 h). En las pruebas de fermentación se utilizó D-glucosa, y de resultar esta prueba positiva, se ensayaron D-galactosa, maltosa, sacarosa, lactosa y rafinosa. En las pruebas de asimilación de compuestos carbonados se ensayaron 37 compuestos diferentes, D-glucosa (control positivo), D-galactosa, L-sorbosa, celobiosa, lactosa, maltosa, melibiosa, sacarosa, a,a-trealosa, melezitosa, rafinosa, inulina, almidón soluble, D-xilosa, D-ribosa, L y D-arabinosa, L-ramnosa, glycerol, meso-eritritol, ribitol, xilitol, L-arabinitol, D-glucitol, D-manitol, galactitol, myo-inositol, metanol, etanol, 2-ceto-D-gluconato, ácido DL-láctico, ácido succínico, ácido cítrico, a-metil-Dglucósido, salicina, arbutina y D-glucosamina, y en las de asimilación de compuestos nitrogenados, cinco: sulfato de amonio 0,05% p/v (control positivo); nitrato de potasio 0,078% p/v; nitrito de sodio 0,02% p/v; etilamina 0,06% p/v; y L-lisina 0,05% p/v. En los controles negativos las fuentes carbonadas o nitrogenadas se reemplazaron por agua destilada estéril. Adicionalmente y para control del método, se ensayaron cepas de levaduras de referencia.

Ensayos de sensibilidad a toxinas killer
La evaluación de la sensibilidad de las levaduras provenientes de aislamientos clínicos a las toxinas producidas por cepas killer se realizó utilizando la técnica de inhibición del crecimiento en placas de agar YEPD-MB (p/v= 0,3% extracto de levadura; 1% glucosa; 0,5% peptona; 0,3% extracto de malta y 2% agar), amortiguado a pH 4,5 con solución reguladora de fosfato-citrato 0,5 M y adicionado con 0,003% p/v de azul de metileno (23).
Se sembraron suspensiones de 1x106 células/ml de cada uno de los aislamientos por la técnica de agar en placa. Se dejó solidificar y a continuación se sembraron estrías de las cepas killer de referencia e indígenas. Las placas se incubaron a 18°C durante 48-72 h. Las levaduras en estudio se consideraron «sensibles a las toxinas» cuando alrededor de la estría de la levadura killer se observó un halo de inhibición del crecimiento, delimitado o no por un halo azul de células muertas. La ausencia del halo de inhibición del crecimiento indicó resistencia de la levadura a la toxina producida por la cepa killer (Figura 1).


Figura 1. Evaluación de la sensibilidad de aislamientos de levaduras de origen clínico frente a levaduras killer de referencia. Ensayo de inhibición del crecimiento en placa. Estrías: levaduras killer. A partir de la flecha y en sentido horario: S. cerevisiae K1, S. cerevisiae K2, S. cerevisiae K3, P. anomala K8, P. anomala K5, C. glabrata K4, C. valida K7, K. marxianus K6, K. lactis K10 y W. saturnus K9; en el centro nuevamente W. saturnus K9. Césped: C. glabrata aislada de exudado vaginal (Hospital Castro Rendón); los halos de inhibición evidencian su sensibilidad a las toxinas producidas por las cuatro primeras levaduras killer enumeradas.

RESULTADOS Y DISCUSIÓN

Identificación de las levaduras provenientes de aislamientos clínicos

Los patrones de restricción (ITS-RFLP) obtenidos para los aislamientos clínicos permitieron identificar ocho especies de levaduras: Candida albicans (52%) , Candida parapsilosis (17%) , Candida tropicalis (10%) , Candida krusei (5%) , Candida glabrata (4%) , Candida guilliermondii (4%) , Kluyveromyces lactis (4%) y Saccharomyces cerevisiae (4%) (Tabla 2). Este resultado evidencia una gran similitud entre la diversidad de levaduras responsables de micosis no sistémicas encontrada en este trabajo y la comunicada para levaduras causantes de micosis sistémicas en un estudio multicéntrico realizado en el país (20), al menos en lo que a especies mayoritarias se refiere.

Tabla 2. Origen e identificación (ITS-RFLP) de los aislamientos de levaduras procedentes de centros de salud

En las condiciones de estudio, el 69% de los aislamientos pertenecientes a C. albicans provinieron de infecciones vaginales (Tabla 2). Esta especie es considerada como la responsable del 94% de los casos de candidiasis vulvovaginal en la Argentina (19). Con respecto a las infecciones oculares, nuevamente C. albicans es la especie encontrada con mayor frecuencia en el mundo (27), seguida por C. tropicalis y C. parapsilosis (16). En nuestro trabajo, si bien las tres especies fueron identificadas en infecciones oculares, la especie mayoritaria fue C. parapsilosis, con el 61% de los aislamientos (Tabla 2). Es interesante destacar que dos de las tres levaduras aisladas de micosis de piel correspondieron a S. cerevisiae (Tabla 2), una especie considerada no patógena.

Sensibilidad a toxinas killer

La sensibilidad a toxinas killer de los 53 aislamientos de levaduras de origen clínico se evaluó frente a 10 cepas de levaduras killer de referencia definidas como de tipos K1 a K10 (Tabla 3) sobre la base de sus diferentes mecanismos de acción o espectros de actividad (24, 31), y frente a 46 aislamientos de levaduras killer indígenas de la Patagonia, de origen enológico (Tabla 1).

Tabla 3. Sensibilidad de las levaduras de origen clínico frente a cepas de levaduras killer de referencia

En las condiciones de ensayo, el 100% de los aislamientos clínicos de levaduras pertenecientes a C. krusei y K. lactis fueron resistentes a todas las toxinas producidas por las cepas killer de referencia (Tabla 3), pero sensibles a la toxina producida por la cepa killer indígena S. cerevisiae MMF9 (Tablas 1 y 4). Estos aislamientos, procedentes mayoritariamente de infecciones vaginales, mostraron una sensibilidad diferente frente a ciertas cepas killer indígenas pertenecientes a P. kluyveri (Tabla 4). Por otro lado, el 100% de los aislamientos de C. guilliermondii y C. tropicalis fueron resistentes a todas las toxinas producidas por las levaduras killer indígenas (Tabla 4), pero sensibles a las toxinas producidas por las cepas killer de referencia P. anomala K8 y S. cerevisiae K1, respectivamente (Tabla 3). Las otras especies mayoritarias, C. albicans y C. parapsilosis, presentaron un 30% y un 77% de aislamientos resistentes a toxinas producidas por cepas killer de colección, respectivamente. Aunque estos aislamientos resultaron sensibles a algunas de las toxinas producidas por las cepas killer indígenas identificadas como P. anomala y P. kluyveri (datos no mostrados). Las levaduras pertenecientes a la especie minoritaria C. glabrata fueron mayoritariamente sensibles a las toxinas killer producidas por levaduras de los géneros Pichia y Saccharomyces tanto de referencia como de colección (Tablas 3 y 4), mientras que las pertenecientes a la especie S. cerevisiae presentaron un amplio espectro de sensibilidad, también observado para los aislamientos sensibles de C. albicans (Tablas 3 y 4)

Tabla 4. Sensibilidad de las levaduras aisladas de materiales clínicos frente a levaduras killer indígenas de la Patagonia

En resumen, los resultados presentados evidencian que la sensibilidad de las levaduras aisladas de materiales clínicos es diferente para cada especie ensayada. Si bien en las condiciones de ensayo todas las levaduras aisladas resultaron sensibles a alguna de la toxinas producidas por las cepas killer de colección o indígenas, ninguna de éstas presentó simultáneamente capacidad antifúngica contra todos los aislamientos.
Aunque varias toxinas killer con actividad biológica frente a hongos oportunistas han sido comunicadas (2, 29), su uso para profilaxis aún es escaso. En particular, existen referencias de una toxina killer producida por Pichia anomala con actividad frente a Pneumocystis carinii (25) y de una toxina producida por Williopsis saturnus efectiva frente a diferentes levaduras aisladas de materiales clínicos (3).
En el presente trabajo, las toxinas producidas por levaduras killer pertenecientes a la especie P. anomala también mostraron una gran efectividad frente a las levaduras de origen clínico. En particular, el aislamiento indígena 15 de P. anomala fue capaz de inhibir el desarrollo del 78% de los aislamientos de C. albicans, del 66% de los de C. parapsilosis y del 50% de los de C. glabrata (Tabla 4). El aislamiento 19 perteneciente a la especie P. kluyveri también presentó un fenotipo killer de amplio espectro de acción. En conjunto, las toxinas producidas en las condiciones ensayadas por estos dos aislamientos killer indígenas, identificados de acuerdo con su origen como P. anomala DVMais 5 y P. kluyveri HCMeiss 5 (Tabla 1), fueron capaces de inhibir el crecimiento del 51% de las levaduras evaluadas (Tabla 4).
Finalmente, el comportamiento killer del aislamiento indígena 15 de P. anomala frente a los aislamientos de levaduras de origen clínico resultó diferente del observado en las dos cepas killer de referencia de la misma especie (Tablas 3 y 4). Este resultado podría estar indicando la presencia de una nueva toxina killer en poblaciones indígenas de la especie P. anomala.

Agradecimientos: al Dr. Luis Pianciola y al personal de los laboratorios de los Hospitales Heller y Castro Rendón de la ciudad de Neuquén, quienes facilitaron las muestras para este estudio. Al Dr. Brunzini y al personal del laboratorio de su centro oftalmológico, quienes aislaron las levaduras patógenas oculares. A la Universidad de Valencia y al CSIC (España) por permitirnos el acceso a la base de datos www.yeast-id.com para la identificación de levaduras. Este trabajo fue realizado en el marco de los proyectos 04 I-117 y PE 356 de la Universidad Nacional del Comahue y del PIP 6494 del CONICET.

BIBLIOGRAFÍA

1. Abranches J, Valente P, Nobrega HN, Fernandez FAS, Mendoncahagler LC, Hagler AN. Yeast diversity and killer activity dispersed in fecal pellets from marsupials and rodents in a Brazilian tropical habitat mosaic. FEMS Microbiol Ecol 1998; 26: 27-33.
2. Buzzini P, Martini A. Large-scale screening of selected Candida maltosa, Debaryomyces hansenii and Pichia anomala killer toxin activity against pathogenic yeasts. Med Mycol 2001; 39: 479-82.
3. Buzzini P, Corazzi L, Turchetti B, Buratta M, Martín A. Characterization of the in vitro antimycotic activity of a novel killer protein from Williopsis saturnus DBVPG 4561 against emerging pathogenic yeasts. FEMS Microbiol Lett 2004; 238: 359-65.
4. Chen SCA, Halliday CL, Meyer W. A review of nucleic acidbased diagnostic tests for systemic mycoses with an emphasis on polymerase chain reaction-based assays. Med Mycol 2002; 40: 333-57.
5. Ciardo DE, Schär G, Böttger EC, Altwegg M, Bosshard PP. Internal transcribed spacer sequencing versus biochemical profiling for identification of medically important yeasts. J Clin Microbiol 2006; 44: 77-84.
6. de Llanos R, Querol A, Planes AM, Fernández-Espinar MT. Molecular characterization of clinical Saccharomyces cerevisiae isolates and their association with non-clinical strains. System Appl Microbiol 2004; 27: 427-35.
7. Dismukes WE . Introduction to antifungal drugs. Clin Infect Dis 2000; 30: 653-7.
8. Esteve-Zarzoso B, Belloch C, Uruburu F, Querol A. Identification of yeasts by RFLP analysis of the 5.8S rRNA gene and two ribosomal internal transcribed spacers. Int J Syst Bacteriol 1999; 49: 329-37.
9. Fidel PL. History and new insights into host defense against vaginal candidiasis. Trends Microbiol 2004;12: 220-7.
10. García Heredia M, García SD, Copolillo EF, Cora Eliseth M, Barata AD, Vay CA, et al. Prevalencia de candidiasis vaginal en embarazadas. Identificación de levaduras y sensibilidad a los antifúngicos. Rev Argent Microbiol 2006; 38: 9-12.
11. Groll, AH. Emerging targets for the development of novel antifungal therapeutics. Trends Microbiol 1998; 6: 117-24.
12. Izgu F, Altinbay D. Killer toxins of certain yeast strains have potential growth inhibitory activity on gram-positive pathogenic bacteria. Microbios 1997; 89: 15-22.
13. Kurtzman C, Fell J. The yeast, a taxonomic study. Fourth edition, Amsterdam, Elsevier Science. 1998.
14. Law D, Moore CB, Joseph LA, Keaney MGL, Denning DW. High incidence of antifungal drug resistance in Candida tropicalis. Int J Antimicrobial Agents 1996; 7: 241-5.
15. López C, Giro L, Ramos L, Ramadán S, Bulacio L. Comparación de diferentes métodos para la identificación de especies del género Candida. Rev Argent Microbiol 2005; 37: 16-21.
16. Muallen M, Alfonso E, Romano A, Miller D, Kurstin J, Marangon F, et al. Bilateral Candida parapsilosis interface keratitis after laser in situ keratomileusis. J Catarct Refract Surg 2003; 29: 2022-5.
17. Page CP, Curtis MJ, Sutter MC, Walter MJ, Hoffman, BB. Farmacología Integrada . Madrid, Harcourt Brace. 1998.
18. Patel A, Gillespie B, Sobel J, Leaman D, Nyirjesy P, Weitz B, et al. Risk factors for recurrent vulvovaginal candidiasis in women receiving maintenance antifungal therapy: Results of a prospective cohort study. Am J Obs Gyn 2004; 190: 644-53.
19. Rodero L, Davel G, Córdoba S, Soria M, Canteros C, Hochenfellner F, et al. Estudio multicéntrico sobre candidiasis nosocomial en la República Argentina. Rev Argent Microbiol 1999; 31: 114-9.
20. Rodero L, Davel G, Soria M, Vivot W, Córdoba S, Canteros CE, et al. Estudio multicéntrico de fungemias por levaduras en la República Argentina. Rev Argent Microbiol 2005; 37: 189-95.
21. Sanglard D, Odds F. Resistance of Candida species to antifungal agents: molecular mechanisms and clinical consequences. Lancet Infect Dis 2002; 2: 73-85.
22. Sangorrín M, Zajonskovsky I, van Broock M, Caballero A. The use of killer biotyping in an ecological survey of yeast in an old patagonian winery. World J Microbiol Biotechnol 2002; 18: 115-21.
23. Sangorrín M, Zajonskovsky I, Lopes C, Rodríguez M, Van Broock M, Caballero A. Killer behaviour in wild wine yeasts associated with Merlot and Malbec type musts spontaneously fermented from Northwestern Patagonia. J Basic Microbiol 2001; 41: 105-13.
24. Schmitt MJ, Breinig F. The viral killer system in yeast: from molecular biology to application. FEMS Microbiol Rev 2002; 26: 257-76.
25. Séguy N, Polonelli L, Dei-Cas E, Cailliez JC. XVIII Effect of a killer toxin of Pichia anomala to Pneumocystis. Perspectives in the control of Pneumocystis. FEMS Immunol Med Microbiol 1998; 22: 145-9.
26. Sullivan DJ, Moran GP, Pinjon E, Al-Mosaid A, Stockes C, Vaughan C, et al. Comparison of the epidemiology, drug resistance mechanisms, and virulence of Candida dubliniensis and Candida albicans. FEMS Yeast Research 2004; 4: 369-76.
27. Thomas, PA. Current perspectives on ophthalmic mycoses. Clin Microbiol Rev 2003; 16: 730-97.
28. Vargas-Montiel H. Patógenos emergentes en micosis cutáneas y sistémicas. Dermatología Venezolana 2004; 42: 4-18.
29. Walker GM, McLeod AH, Hodgson VJ. Interaction between killer yeast and pathogenic. FEMS Microbiol Lett 1995; 127: 213-22.
30. White TJ, Bruns T, Lee S, Taylor J . PCR protocols A guide to methods and applications. En: Innis MA, Gelfand DH, Sninsky JJ, With TJ, editors. Amplification and Direct Sequencing of Fungal Ribosomal RNA Genes for Phylogenetics. San Diego, Academic Press, 1990, pp 315-22.
31. Young TW. Killer yeasts En: Rose AH, Harrison JS, editors. The yeasts. London: Academic Press, 1987; pp 131-64.         [ Links ]         [ Links ]         [ Links ]         [ Links ]         [ Links ]         [ Links ]         [ Links ]         [ Links ]         [ Links ]         [ Links ]         [ Links ]         [ Links ]         [ Links ]         [ Links ]         [ Links ]         [ Links ]         [ Links ]         [ Links ]         [ Links ]         [ Links ]         [ Links ]         [ Links ]         [ Links ]         [ Links ]         [ Links ]         [ Links ]         [ Links ]         [ Links ]         [ Links ]         [ Links ]         [ Links ]

Recibido: 12/03/07 - Aceptado: 25/09/07

Creative Commons License Todo el contenido de esta revista, excepto dónde está identificado, está bajo una Licencia Creative Commons