SciELO - Scientific Electronic Library Online

 
vol.41 número4Amplificación del genoma completo del subtipo 2 del virus de la influenza equinaMycobacterium bovis en Argentina: aislamientos de gatos tipificados por spoligotyping índice de autoresíndice de materiabúsqueda de artículos
Home Pagelista alfabética de revistas  

Servicios Personalizados

Articulo

Indicadores

  • No hay articulos citadosCitado por SciELO

Links relacionados

  • En proceso de indezaciónCitado por Google
  • No hay articulos similaresSimilares en SciELO
  • En proceso de indezaciónSimilares en Google

Bookmark


Revista argentina de microbiología

versión On-line ISSN 1851-7617

Rev. argent. microbiol. v.41 n.4 Ciudad Autónoma de Buenos Aires oct./dic. 2009

 

INFORME BREVE

Brote de micoplasmosis clínica por Mycoplasma ovis en ovinos de Salta, Argentina. Diagnóstico clínico, microbiológico y molecular

D. H. Aguirre*1, C. Thompson2, R. D. Neumann1, A. O. Salatin1, A. B. Gaido1, S. Torioni de Echaide2

1Estación Experimental Agropecuaria Salta, CC 228 (4400) Salta,
2Estación Experimental Agropecuaria Rafaela, (2300) Rafaela, Santa Fe; Instituto Nacional de Tecnología Agropecuaria, Argentina.

*Correspondencia. E-mail: daguirre@correo.inta.gov.ar

RESUMEN

Mycoplasma ovis es un parásito obligado de los eritrocitos de los pequeños rumiantes (ovinos, caprinos), en los que
produce anemia crónica o aguda. Su distribución es mundial, aunque se desconoce la difusión de esta bacteria en la Argentina. Este trabajo describe un brote de micoplasmosis en un rebaño ovino de la localidad salteña de Rosario de la Frontera, ocurrido en enero de 2007. Durante ese brote resultó afectada la categoría de ovinos adultos, con una mortalidad del 17,8%. El diagnóstico en extendidos de sangre (tinción de Giemsa) reveló pequeños cuerpos basófilos, característicos de la infección por M. ovis, en todas las muestras examinadas (n = 11), lo que indica una alta prevalencia de la infección en la majada. El diagnóstico molecular (n = 9) confirmó los hallazgos mediante la amplificación de dos fragmentos del gen 16S rRNA. Este representa el tercer registro del microorganismo en la Argentina y el primero con expresión clínica a escala poblacional (rebaño).

Palabras clave: Mycoplasma ovis; Ovinos; Brote; Argentina.

ABSTRACT

Clinical mycoplasmosis outbreak due to Mycoplasma ovis in sheep from Salta, Argentina. Clinical, microbiological and molecular diagnosis. Mycoplasma ovis is an obligatory parasite of the erythrocytes from small ruminants (sheep, goat), wherein it causes chronic or acute anaemia. This agent shows worldwide distribution. However, its dispersion is still unknown in Argentina. This work describes an outbreak of mycoplasmosis occurred in January 2007 in a sheep flock from Rosario de la Frontera, Salta, Argentina. Adult sheep became ill with a mortality rate of 17.8%. All blood smears (n = 11) examined by Giemsa stain showed the presence of small basophile bodies characteristic of M. ovis infection, indicating a high prevalence of the infection in the flock. The molecular diagnosis (n = 9) confirmed the findings through the amplification of two fragments from the 16S rRNA gene. This is the third report of M. ovis in Argentina and the first one concomitant with clinical signs at flock level.

Key words: Mycoplasma ovis; Sheep; Outbreak; Argentina.

Mycoplasma ovis, hasta hace poco Eperythrozoon ovis, es una bacteria pleomórfica y un parásito obligado de los hematíes de ovinos y caprinos, no cultivable en medios artificiales. Hoy integra el grupo de micoplasmas conocido como hemoplasmas, con rasgos patogénicos antes no considerados entre los Mollicutes (8, 9). Este agente fue descrito en 1934 por Neitz et al. (10) en Sudáfrica, y desde entonces se lo diagnosticó en todo el mundo (8, 9). En Argentina, las únicas referencias previas de M. ovis corresponden a las regiones Noreste, provincia de Corrientes (15), y Noroeste, provincia de Salta (1).
Esta bacteria se transmite por artrópodos hematófagos y por fómites. Hasta ahora son pocas las especies de vectores comprobadas, que comprenden garrapatas (Haemaphysalis plumbeum y Rhipicephalus bursa) y mosquitos (Aedes camptorhynchus y Culex annulirostris) (9). Mycoplasma ovis se puede trasmitir también de manera artificial por el uso de instrumental común en distintas prácticas ganaderas, como vacunaciones, esquila o aplicación de caravanas (2, 8).
La infección por M. ovis es generalmente asintomática, aunque se han descrito cuadros clínicos de curso crónico y agudo. La forma crónica se caracteriza por anemia moderada, fatiga y menor producción de carne y lana (3, 4). En animales portadores, la anemia puede eventualmente acentuarse por estrés, inmunosupresión o enfermedades concurrentes (8). La forma aguda cursa con fiebre, anemia grave, ictericia, depresión, pérdida de peso y muerte (12, 13). Los ovinos infectados mantienen el agente durante períodos prolongados (2, 5, 11), aun después de la terapia con antibióticos eficaces (8, 9). Con la coloración de Giemsa, M. ovis se observa en la superficie de los eritrocitos como pequeños organismos basófilos cocoides de 0,5 a 1,0 μm de diámetro (9). El gen 16S rRNA ha sido usado como marcador para la caracterización molecular y en estudios taxonómicos de Mycoplasma spp. en diferentes hospedadores (6, 8, 9).
Este trabajo informa sobre los aspectos epidemiológicos, clínicos y métodos de diagnóstico empleados en un brote de micoplasmosis ovina ocurrido en cercanías de Rosario de la Frontera (25°48'S, 64°58'O), Salta, en una pequeña majada integrada poco antes por ovinos de origen local diverso. El rebaño se componía de 39 animales, 28 adultos y 11 crías de hasta dos meses de edad. Alrededor de un mes antes del primer deceso, la majada había sido vacunada contra clostridiosis y desparasitada con ivermectina vía inyectable. El rebaño soportaba una elevada incidencia de insectos hematófagos (especies no determinadas) al momento del brote.
En enero de 2007 murieron cinco animales adultos (17,8%), uno el día 5, otro el 16, dos el 17 y uno el 18. El día 19 se efectuaron las necropsias de dos ovejas muertas. Con sangre de una de ellas se realizaron extendidos finos y gruesos, los que se colorearon con Giemsa al 10% y se examinaron al microscopio con objetivo de inmersión (100X) para detectar la presencia de hemoparásitos.
Los días 19, 21 y 23 de enero todos los ovinos recibieron tratamientos con tetraciclina inyectable (Oxiton, Agropharma, Argentina) en dosis de 5 mg/kg. En los días siguientes no ocurrieron nuevos decesos. El 26 de enero se realizaron extendidos de sangre periférica (oreja) y se obtuvieron muestras de sangre con anticoagulantes (EDTA, citrato de sodio al 5%) de 10 ovinos adultos del rebaño. Los extendidos se procesaron y examinaron como antes se refirió. Las muestras con EDTA se utilizaron para determinar el índice hematocrito mediante la técnica del microhematocrito, mientras que las muestras citratadas se emplearon para conocer la identidad genómica de Mycoplasma spp. por la técnica de la reacción en cadena de la polimerasa (PCR) y el análisis de la secuencia del producto amplificado.
Para realizar la PCR se utilizaron los oligonucleótidos 340F y 543R, previamente descritos (9), y otros diseñados ad hoc (Myc783F AGTAGTCCACGCCGTAAACGAT y Myc764R TCAGTTATATCCCAGGTACTCGCC) a partir de la secuencia del gen 16S rRNA de M. ovis de referencia (AF338268). Los productos amplificados se purificaron (Qiagen®) y se enviaron a secuenciar. Las secuencias resultantes se alinearon mediante el programa informático Bioedit® y se compararon con la secuencia de referencia de M. ovis y de Mycoplasma wenyonii (AF016546) (9). Los análisis filogenéticos se realizaron mediante el programa Mega 4 utilizando el método Neighbor-joining (corrección de Kimura-2 parámetros) (14).
Las necropsias mostraron alteraciones similares en ambas ovejas: anemia, ligera ictericia subcutánea, marcada ictericia hepática, esplenomegalia, riñones friables y congestión y edema pulmonares. El estado nutricional de los animales era óptimo, según reflejaban gruesos depósitos adiposos abdominales. En ninguna de las ovejas se hallaron nematodes abomasales (i.e. Haemonchus contortus), a menudo responsables de mortalidad estivootoñal por anemia en los ovinos de la región. Tampoco se observaron ectoparásitos (melófagos, piojos o garrapatas) fijados a la piel o lana de las ovejas.
La sangre de una de las ovejas muertas reveló al examen microscópico múltiples cuerpos basófilos adheridos a los eritrocitos, acordes con las descripciones de M. ovis. Cuerpos idénticos se observaron también, en menor número, en todos los extendidos de sangre obtenidos de los ovinos sobrevivientes (Figura 2). En ningún caso los extendidos mostraron cambios significativos del cuadro hemático (reticulocitosis, anisocitosis, etc.). La media del índice de hematocrito de los 10 ovinos muestreados fue de 33,0 (rango 24-37).


Figura 1. Árbol filogenético obtenido mediante un análisis de Neighbor-joining (Kimura-2 parámetros) a partir del alineamiento de las secuencias de referencia de M. ovis y M. wenyonii. Acholeplasma laidlawii fue usado como grupo externo. En los nodos del árbol se aclara el valor obtenido en la prueba estadística de bootstrap (1000 repeticiones). El análisis se efectuó con el programa informático Mega 4. Entre paréntesis se muestra el número de acceso a GenBank de cada secuencia. Las nuevas secuencias obtenidas fueron depositadas en el GenBank (N° de acceso FJ866785).


Figura 2. Extendido de sangre ovina. Glóbulos rojos con presencia de formas cocoides sobre su superficie (flechas), compatibles con Mycoplasma ovis. Coloración de Giemsa. 1000 x

En nueve de las nueve muestras analizadas se lograron amplificar dos fragmentos del gen 16S rRNA, uno de 224 pb con los oligonucleótidos Myc340F-Myc543R y otro de 417 pb con los oligonucleótidos Myc340F-Myc764R. Sólo tres secuencias del gen 16S rRNA resultaron legibles e idénticas entre sí y fueron depositadas en el GenBank (N° de acceso FJ866785). Ambas mostraron un 98% de similitud, tanto con la secuencia de M. ovis (AF338268) como con la de M. wenyonii (AF016546). La Figura 1 presenta un árbol filogenético con la relación entre estas últimas dos secuencias y los tres fragmentos secuenciados. Estos resultados confirman la gran similitud entre M. ovis y M. wenyonii, previamente observada por otros autores, tanto inmunológica (7) como filogenética (9). Como M. wenyonii es considerado específico de los bovinos (8), la hipótesis de una eventual infección de los ovinos con este agente se estima improbable.
Los cambios anatomopatológicos sumados a la anamnesis y al diagnóstico microscópico y molecular prueban la acción patógena de M. ovis en el caso aquí referido. Esta bacteria se diagnostica de rutina por el examen directo de extendidos de sangre coloreados, si bien la baja parasitemia de las infecciones crónicas puede conducir a resultados falso negativos. El diagnóstico definitivo requiere entonces la inoculación de sangre de animales sospechosos en ovinos -o caprinos- esplenectomizados, o bien el empleo de técnicas de biología molecular, como la utilizada en esta investigación (8).
Es probable que la tasa de mortalidad de este brote de micoplasmosis hubiese sido mayor en ausencia de las medidas terapéuticas aplicadas. La mortalidad se circunscribió a ovinos adultos, como hace poco ocurrió en un rebaño de Hungría, donde murió el 5,5% de las ovejas adultas (6). La prevalencia de la infección fue muy elevada, ya que el 100% de los ovinos muestreados (n = 11) exhibieron presencia de M. ovis. La transmisión pudo verse favorecida por la abundancia de insectos hematófagos o por iatrogenia asociada a medicaciones inyectables administradas con anterioridad en el rebaño.
El presente brote resultó curioso dados los escasos precedentes sobre esta infección. Aunque se postula que la distribución de M. ovis es amplia en las áreas del norte argentino con abundancia de vectores (15), la primera sospecha de su relevancia patógena a nivel local surgió hace poco, tras la muerte de un carnero trasladado de Córdoba a Salta (1). Pero ese caso aislado no permitió mayores inferencias sobre el origen de la infección por M. ovis y su patogenicidad. Por el contrario, el brote en ovinos nativos de Salta que aquí se describe confirma la presencia regional del agente y aporta evidencia contundente de su acción deletérea a escala poblacional, la que desde ahora deberá contemplarse para el diagnóstico nosológico diferencial.

BIBLIOGRAFÍA

1. Aguirre D, Cafrune M, Arjona C, Venzano A. Micoplasmosis (eperythrozoonosis) ovina en Salta, Argentina. XVII Congreso Latinoamericano de Parasitología, Resumen 187. Parasitol Latinoam 2005; 60: 173.        [ Links ]

2. Brun-Hansen H, Gronstol H, Waldeland H, Hoff B. Eperythrozoon ovis infection in a commercial flock of sheep. Zentbl Veterinarmed B 1997; 44: 295-9.        [ Links ]

3. Burroughs GW. The significance of Eperythrozoon ovis in ill-thrift in sheep in the eastern Cape coastal areas of South Africa. J S Afr Vet Assoc 1988; 59: 195-9.        [ Links ]

4. Daddow KN. Eperythrozoon ovis - a cause of anaemia, reduced production and decreased exercise tolerance in sheep. Aust Vet J 1979; 55: 605-6.        [ Links ]

5. Daddow KN. The duration of the carrier state of Eperythrozoon ovis infection in sheep (letter). Aust Vet J 1981; 57: 49.        [ Links ]

6. Hornok S, Meli ML, Erdos A, Hajtós I, Lutz H, Hofmann-Lehmann R. Molecular characterization of two different strains of haemotropic mycoplasmas from a sheep flock with fatal haemolytic anaemia and concomitant Anaplasma ovis. Vet Microbiol 2009; 136: 372-7.        [ Links ]

7. Kreier JP, Ristic M. Morphologic, antigenic and pathogenic characteristics of Eperythrozoon ovis and Eperythrozoon wenyoni. Am J Vet Res 1963; 24: 488-500.        [ Links ]

8. Messick JB. Hemotropic mycoplasmas (hemoplasmas): a review and new insights into pathogenic potential. Vet Clin Pathol 2004; 33: 2-13.        [ Links ]

9. Neimark H, Hoff B, Ganter M. Mycoplasma ovis comb. nov. (formerly Eperythrozoon ovis), an epierythrocytic agent of haemolytic anaemia in sheep and goats. Int J Syst Evol Microbiol 2004; 54: 365-71.        [ Links ]

10. Neitz WO, Alexander RA, Du Toit PJ. Eperythrozoon ovis (sp. nov.) infection in sheep. Onderstepoort J Vet Sci 1934; 3: 263-9.        [ Links ]

11. Overas J. Studies on Eperythrozoon ovis - infection in sheep. Acta Vet Scand 1969; Suppl 28: 1-148.        [ Links ]

12. Rouse BT, Johnson RH. Eperythrozoon ovis. Vet Rec 1966; 79: 223-4.        [ Links ]

13. Sheriff D, Clapp KH, Reid MA. Eperythrozoon ovis infection in South Australia. Aust Vet J 1966; 42: 169-76.        [ Links ]

14. Tamura K, Dudley J, Nei M, Kumar S. MEGA4: Molecular Evolutionary Genetics Analysis (MEGA) software version 4.0. Mol Biol Evol 2007; 24: 1596-9.        [ Links ]

15. Vanzini VR, Somma de Fere GR, Zurbriggen MA, Homse AC, Draghi de Benítez MG, Rochinotti D, et al. Hallazgo de Eperythrozoon ovis en la provincia de Corrientes (Argentina). IDIA 1983; 417- 420: 105-7.        [ Links ]

Recibido: 21/04/09
Aceptado: 28/07/09