SciELO - Scientific Electronic Library Online

 
vol.42 número3Análisis microbiológico, epidemiológico y evolución clínica de los pacientes con bacteriemia en el Hospital Zonal de Esquel en el período 2007-2009Peritonitis tuberculosa en pacientes infectados por el virus de la inmunodeficiencia humana índice de autoresíndice de materiabúsqueda de artículos
Home Pagelista alfabética de revistas  

Servicios Personalizados

Articulo

Indicadores

  • No hay articulos citadosCitado por SciELO

Links relacionados

  • En proceso de indezaciónCitado por Google
  • No hay articulos similaresSimilares en SciELO
  • En proceso de indezaciónSimilares en Google

Bookmark


Revista argentina de microbiología

versión On-line ISSN 1851-7617

Rev. argent. microbiol. vol.42 no.3 Ciudad Autónoma de Buenos Aires jul./set. 2010

 

MICROBIOLOGÍA CLÍNICA Y ENFERMEDADES INFECCIOSAS

Comparación de métodos diagnósticos de diarreas asociadas a Clostridium difficile

F. M. Trejo1, 2, M. E. Rusconi1, 2, L. Guzzetti1, 2, M. I. Zamboni3, M. C. Guardati4, S. Lejona3, P. F. Pérez1, 2 *

1Cátedra de Microbiología, Departamento de Ciencias Biológicas, Facultad de Ciencias Exactas, UNLP;
2CIDCA - CCT - La Plata, CONICET;
3Centro de Especialidades Médicas Ambulatorias (CEMAR), Rosario;
4Hospital de Emergencias Dr. Clemente Álvarez (HECA), Rosario, Argentina.
*Correspondencia. E-mail: pfp@biol.unlp.edu.ar

RESUMEN

Para comparar diferentes métodos de diagnóstico de diarreas asociadas a Clostridium difficile desarrollados en el marco de un estudio colaborativo, se analizaron filtrados de materia fecal de pacientes con sintomatología compatible con esta patología. Se evaluó la actividad biológica sobre células Vero (ensayo biológico), la reactividad frente a anticuerpos anti-TcdA y anti-TcdB (dot blot) y la presencia de secuencias del gen tcdB por PCR. De 177 muestras analizadas por el ensayo biológico, 44 tuvieron títulos mayores o iguales que 64. Diecinueve muestras fueron a la vez positivas en el ensayo biológico y en el análisis por PCR. Se analizaron 149 muestras por dot blot utilizando anticuerpos anti-TcdA y anti-TcdB; 46 muestras resultaron positivas para ambas toxinas, 12 muestras fueron positivas sólo para TcdB y 5 muestras sólo para TcdA. Las divergencias entre los diferentes métodos podrían estar relacionadas con la presencia de genes truncados, con un bajo número de microorganismos en las muestras analizadas o con la degradación de las toxinas. Los resultados presentados demuestran la necesidad de implementar alternativas diagnósticas que se adapten a la compleja realidad epidemiológica de este importante patógeno intestinal.

Palabras clave: Clostridium difficile; Diagnóstico; PCR; Dot blot; Células Vero

ABSTRACT

Comparison of diagnostic methods for Clostridium difficile-associated diarrhea. In order to compare different methods for the diagnosis of Clostridium difficile-associated diarrhea, fecal filtrates from patients presenting symptoms compatible with this condition, were analyzed. Biological activity on Vero cells (biological assay), dot blot with antibodies anti-TcdA and anti-TcdB, and a PCR assay for the tcdB gene, were evaluated. Titles of biological assays were ≥ 64 for 44 out of 177 samples. Nineteen samples were positive in both biological and PCR assays. The analysis by dot blot using anti-TcdA and anti-TcdB antibodies showed that 46 samples out of 149 were positive for both toxins whereas 12 samples were only positive for TcdB, and 5 samples only positive for TcdA. Discrepancies in the different methods could be related to truncated genes, low number of microorganisms in the samples and toxin degradation. The results herein presented show the need for developing diagnostic approaches compatible with the complex epidemiological situation of this clinically relevant intestinal pathogen.

Key words: Clostridium difficile; Diagnostic; PCR; Dot blot; Vero cells

INTRODUCCIÓN

Clostridium difficile es un bacilo gram positivo formador de esporos que se encuentra ampliamente diseminado en centros nosocomiales como habitante normal en el ambiente. Los principales factores que predisponen a las infecciones por C. difficile son el uso de antibióticos de amplio espectro tales como las cefalosporinas de tercera generación, la clindamicina y la ampicilina o la amoxicilina. El uso de fluoroquinolonas está más fuertemente correlacionado con las infecciones por C. difficile que el uso de β-lactámicos con inhibidores de β-lactamasas o sin ellos (19, 20, 27). Entre otros factores asociados se incluyen edad mayor de 65 años, internación prolongada y admisión a unidades de cuidados intensivos (14).
La presentación clínica de la infección por C. difficile va desde la colonización asintomática a megacolon tóxico y perforación del intestino, que en los casos graves puede llegar a ser mortal (18, 24). Dichas patologías se hallan asociadas a la producción de dos toxinas, TcdA (306 kDa) y TcdB (260 kDa), principales factores de virulencia de C. difficile.
Algunos estudios epidemiológicos realizados en Canadá han demostrado un marcado incremento de las infecciones ocasionadas por C. difficile, cuyo número se elevó de 36 a 156 casos por cada 100 000 pacientes internados entre 1991 y 2003. En el mismo período, la
proporción de complicaciones aumentó de 7,1% a 18,2% y la mortalidad dentro de los 30 días pasó de 4,7% a 13,8%. Similar tendencia ha sido demostrada en estudios realizados en Europa y EE.UU. (21).
En nuestro país existen escasos datos epidemiológicos acerca de las infecciones por C. difficile. Un estudio llevado adelante por Goorhuis et al. (8) sobre muestras de pacientes hospitalarios analizadas entre 2000 y 2005 permitió determinar un importante aumento en el número de aislamientos toxigénicos, con una prevalencia de entre un 40% y un 50% a partir de 2001. En el mismo estudio se pudo establecer un marcado aumento en el número de aislamientos de tipo TcdA-/TcdB+ respecto del toxinotipo TcdA+/TcdB+ a partir de 2001. Esto no sólo demuestra la relevancia que C. difficile presenta para el sistema de salud, sino también el establecimiento y la prevalencia de aislamientos clínicos TcdA-/TcdB+ (8).
Los primeros síntomas indicativos de la infección por C. difficile son diarreas acuosas, dolores abdominales, pérdida de apetito, náuseas y fiebre. Además de estos síntomas, el paciente debe presentar historia de tratamiento con antibióticos o antineoplásicos dentro de las 8 semanas previas a la manifestación del cuadro clínico. Como consecuencia del agravamiento de la colitis, pueden desencadenarse cuadros secundarios graves, entre los cuales se destacan la sepsis, el desequilibrio de electrolitos, la hipotensión, la peritonitis y, en algunos casos, elevado recuento de glóbulos blancos, con altos niveles de creatinina (7, 15).
El reconocimiento de los síntomas no es suficiente para el diagnóstico de C. difficile como agente responsable de la afección, ya que existen otras entidades, como la enfermedad de Crohn o la colitis ulcerosa, que provocan síntomas similares a los causados por la infección por C. difficile. Otros patógenos entéricos también dan lugar a cuadros que no son fácilmente distinguibles del producido por C. difficile (4, 10, 26).
Los métodos más comúnmente utilizados para el diagnóstico se basan en el aislamiento del patógeno y en la detección del antígeno común (glutamato deshidrogenasa) o de las toxinas (22, 27). El aislamiento de la bacteria tiene la principal desventaja que no permite distinguir entre cepas toxigénicas y no toxigénicas, por lo que se debe complementar con algún método que permita detectar toxinas (24). Algo similar ocurre con los métodos basados en la detección del antígeno de superficie, la glutamato deshidrogenasa (32).
El método considerado de referencia o gold standard para el diagnóstico de C. difficile es el ensayo de citotoxicidad sobre células en cultivo, que permite detectar la presencia de la toxina B (13). Este ensayo debe ser confirmado mediante la neutralización de TcdB empleando anticuerpos específicos (28, 31). También existen enzimoinmunoensayos (EIA) para la detección de toxinas de C. difficile que permiten detectar toxina A (ToxA) o la presencia de alguna de ellas, sin diferenciar entre ambas (ToxA/B). Otras técnicas basadas en métodos moleculares implican la detección del gen que codifica la TcdB (tcdB) mediante PCR convencional o PCR en tiempo real (30).
Actualmente, el diagnóstico en nuestro país se realiza mediante equipos comerciales basados en EIA; éstos detectan de manera indistinta la toxina A y/o la B. Estos equipos son importados y de difícil adquisición para muchos de los centros de salud de nuestro país.
El diagnóstico rápido y preciso de este patógeno como causa de la enfermedad permite la instauración temprana del tratamiento adecuado, lo que evita el agravamiento del cuadro y la posible diseminación del agente etiológico a otros pacientes.
A los fines de contribuir al diagnóstico de las diarreas asociadas a C. difficile se desarrollaron dos estrategias diferentes. La primera consistió en la detección de ambas toxinas en forma separada mediante métodos inmunológicos, mientras que la segunda estrategia consistió en la detección del gen tcdB mediante técnicas de biología molecular. Ambas metodologías fueron contrastadas con el ensayo biológico de citotoxicidad sobre células Vero.

MATERIALES Y MÉTODOS

Obtención de filtrados fecales
Se analizó un total de 177 muestras fecales provenientes de pacientes con sintomatología compatible con infección por C. difficile. Para ello, las muestras de materia fecal fueron resuspendidas en igual volumen de solución de NaCl 0,85% (v/v) estéril, homogeneizadas y filtradas a través de membrana de 0,22 μm de diámetro de poro en condiciones de asepsia. Los filtrados obtenidos fueron almacenados a -80 °C hasta su utilización.

Detección de TcdA y TcdB por dot blot
Se realizaron diluciones seriadas al 1/2 de los filtrados fecales en buffer tris-Tween (TTBS), con la siguiente composición: Tris- Base, 6 g/l; NaCl, 5,9 g/l; Tween 20, 0,05% p/v. Las toxinas A y B de C. difficile se detectaron empleando anticuerpos monoclonales comerciales anti-TcdA y anti-TcdB obtenidos en ratón (Meridian Life Science, Inc., EE.UU.).
Alícuotas de 2 μl de las citadas diluciones fueron sembradas sobre membrana de nitrocelulosa (SIGMA, Inc., EE.UU.) e incubadas durante 1 h a 37 °C con solución de bloqueo constituida por leche parcialmente descremada (Svelty, Nestlé, Argentina) al 3% (p/v) en buffer TTBS. Posteriormente se incubaron las membranas durante 1 h a 37 °C con anti-TcdA o anti-TcdB, luego con anti-IgG de ratón conjugada con estreptavidina (SIGMA) durante 40 minutos a 37 °C, y finalmente con solución de fosfatasa alcalina conjugada con biotina (SIGMA) durante 30 minutos a 37 °C. Entre cada incubación, las membranas fueron lavadas 4 veces con TTBS. Para el revelado se empleó como sustrato el sistema BCIP/NBT (SIGMA). Se consideró positiva la presencia de toxina en aquellos filtrados que presentaron un título mayor o igual a 16 frente al respectivo anticuerpo monoclonal específico.

Detección de un fragmento de ADN del gen tcdB por PCR
La detección de un fragmento del gen tcdB se realizó mediante la técnica de PCR (9), a partir de muestras fecales obtenidas de pacientes hospitalizados con cuadros de diarrea e his
toria de tratamiento con antibióticos. Se analizaron en total 177 muestras. Para la extracción del ADN total de la muestra fecal, se empleó un equipo comercial de extracción QIAamp DNA Stool Mini Kit (Qiagen, Argentina), de acuerdo con las instrucciones del fabricante. Las secuencias de los cebadores empleados fueron las siguientes:
CDTB1 (5'GTGGCCCTGAAGCATATG 3')
CDTB2 (5'TCCTCTCTCTGAACTTCTTGC 3')
Estas secuencias amplifican un fragmento de 322 pb correspondiente a una región no repetitiva del gen tcdB (1).
Se utilizaron 6 μl de los extractos de ADN, los que fueron adicionados a la mezcla de reacción cuyo volumen final fue de 25 μl por tubo.
La reacción se llevó a cabo en un termociclador Perkin-Elmer 9600 con el siguiente perfil de amplificación: desnaturalización a 94 °C durante 3 min, 30 ciclos de 94 °C (45 s), 56 °C (45 s) y 72 °C (75 s), y extensión final a 72 °C durante 1 min.
Los amplicones obtenidos fueron resueltos por electroforesis en gel de agarosa al 2% con bromuro de etidio y transiluminación con luz UV. Como control positivo se empleó el ADN de la cepa toxigénica ATCC 43255 y como control negativo ADN purificado de Clostridium perfringens y agua destilada estéril.

Detección de TcdB por determinación de la actividad biológica en cultivos celulares
Se empleó el ensayo biológico sobre células Vero (29). Éstas se hicieron crecer en placas de 96 fosas durante 48 h empleando el medio DMEM (Dulbecco Modified Eagle's Medium, GIBCO, EE.UU.) suplementado con suero fetal bovino (BIOSER, Argentina) al 10% (v/v), previamente inactivado a 60 °C durante 30 min. Para determinar la presencia de TcdB en los filtrados fecales, de éstos se prepararon diluciones seriadas al 1/2 en DMEM sin suplementar, las que fueron agregadas a las fosas que contenían las células. Las placas fueron incubadas en una atmósfera con 5% de CO2 y 95% de aire, y se procedió a su observación microscópica a las 24 h. La actividad biológica de los filtrados fecales se evaluó mediante el efecto citopático que presentaron sobre las células Vero, y se definió como la inversa de la dilución que produjo redondeo en el 50% de las células. La evaluación se realizó por observación microscópica. Para confirmar que la actividad biológica de los filtrados se debía a TcdB, se procedió a realizar el correspondiente ensayo de neutralización empleando el anticuerpo monoclonal comercial contra TcdB (Meridian Life Science). Para ello, las muestras fueron diluidas en DMEM sin suplementar hasta una dilución final de 1/50 para aquellas que presentaban una actividad biológica menor o igual de 500, y de 1/500 para aquellas cuyo título era mayor a 500. Se coincubaron 90 μl de dichas diluciones sobre las células Vero en presencia de 10 μl de anticuerpo monoclonal anti-TcdB (dilución final 1/10). Se realizaron los respectivos controles positivos incubando las mismas diluciones de cada filtrado en ausencia de anticuerpo monoclonal.

Análisis de datos
Para el análisis estadístico se empleó el software InfoStat (Grupo InfoStat, Córdoba, FCA, Universidad Nacional de Córdoba, Argentina). Para comparar los títulos (actividad biológica y dot blots), se utilizó la prueba de la mediana.
Se realizó un estudio de sensibilidad/especificidad tomando como referencia el ensayo biológico. Se determinaron los siguientes parámetros, de acuerdo con los cálculos detallados a continuación:
Sensibilidad = PV/(PV + FN), especificidad = NV/(NV + FP), valor predictivo positivo = PV/(PV + FP), valor predictivo negativo = NV/(NV + FN); donde PV: positivos verdaderos; FP: falsos positivos; NV: negativos verdaderos y FN: falsos negativos.

RESULTADOS

Detección de TcdA y TcdB en muestras fecales
En la Figura 1, a manera de ejemplo, se muestran las imágenes correspondientes al análisis por dot blot de 16 filtrados fecales.


Figura 1. Análisis de filtrados fecales por dot blot con anticuerpos monoclonales comerciales: A) contra TcdA; B) contra TcdB, (+) presencia de toxina, (-) ausencia de toxina.

Se puede observar que los títulos de las muestras 1, 2 y 4 fueron ≥ 32 para ambas toxinas, mientras que en la muestra 15 los títulos contra TcdA y TcdB alcanzaron un valor de 8. El resto de las muestras presentaron títulos ≤ 4.
Considerando un punto de corte de 16, de 149 muestras analizadas mediante dot blot, se detectaron ambas toxinas en 46 muestras (30,9%), sólo toxina B en 12 muestras (8,1%) y sólo toxina A en 5 muestras (3,3%). Las restantes 86 muestras (57,7%) fueron negativas para ambas toxinas. Estos resultados pueden verse en la Figura 2.


Figura 2. Detección de TcdA y TcdB por dot blot en filtrados fecales. El número total de muestras analizadas fue 149.

Detección de tcdB en muestras fecales por PCR
En la Figura 3 se muestra un gel representativo de un análisis de 3 muestras de materia fecal provenientes de pacientes con sintomatología compatible con infección por C. difficile. También se muestran los controles positivo y negativo.


Figura 3. Detección de un fragmento de ADN del gen tcdB en muestras clínicas empleando los cebadores CDTB1 y CDTB2. Tinción con bromuro de etidio en gel de agarosa al 1,4%. Líneas 1 y 3: muestras clínicas positivas; línea 2: muestra clínica negativa; línea 4: control positivo (C. difficile 43255); línea 5: control negativo (C. perfringens); línea 6: patrones de ADN.

A partir de las muestras 1 y 3 se detectó un amplicón cuyo tamaño es coincidente con el obtenido con la cepa de C. difficile de referencia, productora de TcdB (calle 4). Cuando se utilizó ADN de C. perfringens (calle 5), no se observó la banda característica de tcdB de C. difficile. No
se evidenciaron interferencias en las muestras que produjeran otros amplicones de tamaños diferentes al esperado. De 177 muestras analizadas, 35 mostraron reacción positiva por la PCR con los cebadores empleados.

Detección de la actividad biológica de TcdB en cultivos celulares
La actividad citopática de la toxina B de C. difficile sobre células Vero se manifiesta a través de un redondeo celular fácilmente detectable por observación microscópica. A modo de ejemplo, en la Figura 4A se muestra el efecto sobre células Vero de un filtrado proveniente de una muestra clínica. La Figura 4B muestra la monocapa de células Vero sin tratamiento.


Figura 4. Células Vero crecidas en cultivo. (A) tratadas con un filtrado fecal proveniente de un paciente infectado por C. difficile; (B) sin tratar.

Se consideraron TcdB-positivas aquellas muestras con un título mayor o igual a 64. En todos los casos se efectuó la confirmación mediante el ensayo de neutralización con anti-TcdB. De esta forma, se pudo determinar que de 177 muestras analizadas por el ensayo biológico, 44 (24,8%) mostraron actividad asociada a TcdB.

Comparación de los ensayos de dot blot y PCR frente al método biológico
La comparación de los métodos moleculares e inmunoquímicos frente al ensayo biológico permite obtener información de utilidad para diseñar estrategias de diagnóstico.
En la Figura 5 se muestran los resultados de los títulos de reactividad inmunológica frente a TcdB de los filtrados, agrupados según la existencia o no de actividad biológica sobre células Vero. Se analizó un total de 149 muestras por ambos métodos, de las cuales 38 (25,5%) presentaron actividad biológica sobre células Vero. De estas 38 muestras, 20 (13,3% del total evaluado) fueron también reactivas frente a anti-TcdB, con títulos mayores o iguales que 16.


Figura 5. Títulos de dot blot en muestras negativas y positivas en el ensayo biológico con células Vero. Vero (-): sin actividad biológica asociada a TcdB; Vero (+): con actividad biológica asociada a TcdB.

Siempre sobre la base del análisis de las muestras estudiadas por dot blot y ensayo biológico (149 muestras), se registraron 111 muestras negativas mediante este último procedimiento (74,5%), de las cuales 73 (49% del total) fueron además negativas en el análisis por dot blot.
Es de destacar que las muestras positivas por el método biológico presentaron títulos de dot blot que alcanzaron una mediana de 15. En contraste, en las muestras sin actividad biológica asociada a TcdB la mediana del título de dot blot fue de 4. Estas medianas son significativamente diferentes (p = 0,036). La Figura 5 también permite observar la existencia de muestras con actividad biológica de TcdB que no mostraron reactividad por dot blot (títulos menores de 16).
En la Figura 6 se comparan los resultados obtenidos por PCR y por el ensayo biológico. Como puede observarse, la mayoría de las muestras que no presentaron amplificación de tcdB evidenciaron escasa o nula actividad biológica sobre células Vero. Los valores de las medianas del título de actividad biológica en muestras positivas y negativas en el ensayo por PCR fueron 256 y 0, respectivamente. Estos valores son significativamente diferentes (p = 0,0032).


Figura 6. Títulos de actividad biológica sobre células Vero en muestras positivas y negativas mediante el ensayo por PCR para la detección de un fragmento del gen tcdB.

Cuando los títulos de la actividad biológica fueron menores de 128, no se logró amplificar el fragmento del gen tcdB en las muestras analizadas. Este fue detectado en muestras con títulos de actividad biológica mayores de 256, con una frecuencia mayor cuando el título de la actividad biológica era superior a 1042.

DISCUSIÓN

Diversos estudios de tipificación génica de C. difficile han demostrado la existencia de variabilidad en los genes tcdA y tcdB (25). Estas variaciones se originan en deleciones o inserciones que pueden dar lugar a cepas incapaces de producir una o ambas toxinas, o a cepas que producen variantes de las toxinas con actividad biológica modificada. TcdB presenta actividad glucosiltransferasa, la cual es dirigida hacia las proteínas Rho y Rac (GTP-asas). Dicha glucosilación inactiva estas proteínas, lo que activa las vías de señalización que conducen a procesos apoptóticos y a la interferencia en la polimerización de la F-actina. Esto deriva en un efecto citotóxico caracterizado por redondeo celular y apoptosis (23). Es importante destacar que se ha aislado una cepa de C. difficile capaz de producir TcdB sin reactividad en los ensayos biológicos sobre células en cultivo (25). Otras variantes de TcdB identificadas han demostrado diferencias en tamaño e incluso ausencia de inmunorreactividad (6, 12, 25). Las mutaciones presentes en ciertas cepas pueden también provocar modificaciones en la especificidad por sustrato, que se ve reflejada en la falta de actividad citotóxica sobre la célula blanco (11). Sin embargo, el producto de la expresión de tcdB puede presentar epitopes intactos, que dan lugar a reactividad frente a ciertos anticuerpos monoclonales específicos contra TcdB, aunque la toxina sea biológicamente inactiva. Este comportamiento podría explicar las discrepancias halladas entre los resultados encontrados al comparar el método inmunoquímico con el ensayo biológico sobre células Vero.
Un factor que se debe tener en cuenta es que la complejidad en la composición de la materia fecal a partir de la cual se obtienen los filtrados hace posible la reactividad cruzada con los anticuerpos monoclonales contra TcdB.
Se ha informado que la técnica de PCR presenta un límite de detección de 105 UFC/g de muestra (9), por lo que muestras con un menor inóculo de C. difficile no contendrían la cantidad necesaria de ADN para la determinación por este método. Por otro lado, las modificaciones que pudieran presentarse dentro de las regiones que se buscan amplificar generarán un producto de amplificación incompleto, con lo cual la reacción de PCR daría negativa para la presencia del gen en estudio. Esto ha sido demostrado por Minnaard et al. (17) en un estudio de los factores de virulencia de Bacillus cereus. Tal circunstancia podría explicar los resultados en los cuales las muestras dan reacción negativa por PCR y son positivas en el ensayo sobre células Vero.
Un resultado positivo para la presencia del gen tcdB y negativo por el método biológico podría ser consecuencia de deleciones en el gen que resultan en un producto sin actividad biológica; sin embargo, al estar conservada la región reconocida por los cebadores utilizados, se obtienen productos de amplificación.
Es importante destacar que el equipo de extracción de ADN empleado (QIAamp) ofrece una alta eficiencia en la purificación de ADN (9). Sin embargo, no se debe descartar que pudiera existir algún interferente en la materia fecal que no fuera eliminado o inactivado, lo que puede provocar una interferencia con la PCR. Esto podría explicar los casos en que no se detectó la presencia de tcdB por PCR y, sin embargo, la muestra presentó actividad biológica asociada a TcdB. Para detectar la
presencia de inhibidores, Guilbault et al. (9) efectúan la determinación por duplicado y a una de las muestras le agregan ADN proveniente de una cepa toxigénica de C. difficile. Sin embargo, esto representa un componente extra de trabajo, lo cual suele generar complicaciones dado el gran número de muestras que suelen manejarse en el ámbito hospitalario.
Es importante destacar que todas las muestras que presentaron efecto citotóxico sobre las células Vero fueron confirmadas mediante el respectivo ensayo de neutralización con anticuerpo monoclonal contra TcdB. Sin embargo, este anticuerpo monoclonal puede presentar reacción cruzada contra la toxina letal producida por Clostridium sordellii (TcsL), que también es una toxina glicosilante con la misma especificidad que TcdB, y que presenta un efecto citotóxico similar al producido por dicha toxina. Esto podría dar como resultado discrepancias con los estudios por dot blot y PCR. En ese caso, sería el ensayo biológico el que daría un resultado erróneo (2, 16).
Los fenotipos más comúnmente encontrados en cepas de C. difficile son TcdA-/TcdB-, TcdA-/TcdB+ y TcdA+/TcdB+. Se han descrito casos de cepas pertenecientes al fenotipo TcdA+/TcdB-, pero estos hallazgos se han atribuido a fallas en la amplificación debido a variaciones en la secuencia de tcdB (5, 32). A raíz de tales alteraciones, se producen variantes de TcdB que podrían ser biológicamente inactivas y/o sin reactividad frente a los anticuerpos empleados. Dichas cepas se clasificarían dentro de los toxinotipos TcdA+/TcdB+ (25). En el presente trabajo, la detección de muestras TcdA+/TcdB-por dot blot (Figura 2) no debe confundirse con la presencia de cepas con ese fenotipo, ya que el análisis se ha hecho sobre filtrados fecales y no sobre cepas de C. difficile.
Un factor muy importante que debe ser mencionado y que puede influir considerablemente sobre el resultado de una determinación de citotoxicidad es la conservación de la muestra. Bouza et al. (3) han demostrado que filtrados provenientes de muestras fecales presentan actividad citotóxica negativa. Sin embargo, a partir de esas muestras se han aislado microorganismos que al desarrollar en caldo produjeron sobrenadantes con actividad citotóxica sobre las células en cultivo. Los autores argumentan que la diferencia encontrada podría obedecer a la degradación de la toxina en las muestras, con pérdida de la actividad biológica como consecuencia de cambios de temperatura y de actividad proteolítica fecal durante el transporte hasta el laboratorio y el almacenamiento para su posterior análisis. En contraste, los esporos presentes en la muestra, cuando son colocados en condiciones de cultivo, pueden germinar y producir toxinas que son detectadas en los sobrenadantes correspondientes.
La degradación de la toxina podría arrojar un valor falso negativo, no sólo en el ensayo de citotoxicidad, sino también en aquellos que detecten las toxinas de C. difficile. Respecto de las muestras empleadas en el presente estudio, éstas fueron almacenadas a -80 ºC hasta su utilización.
Una forma de detectar errores por degradación de la toxina y también por reacciones cruzadas con TcsL consiste en el aislamiento de C. difficile. Esto sólo sería útil para obtener datos para la tipificación de genes o la validación de metodologías de diagnóstico o estudios epidemiológicos, pero no para el diagnóstico, dado que requeriría de más de 96 horas para obtener el resultado, lo cual es un tiempo demasiado prolongado para establecer el tratamiento clínico contra la infección. Si bien este procedimiento podría mejorar la sensibilidad, la especificidad y la predictividad del análisis, el aislamiento de anaerobios como C. difficile demanda tiempo, lo cual no siempre es compatible con los requerimientos del diagnóstico.
Si se toma como referencia el método biológico, un análisis de sensibilidad/especificidad daría los siguientes resultados para la PCR: sensibilidad 43,2%; especificidad 88%; valor predictivo positivo 54,3% y valor predictivo negativo 82,3%. El mismo análisis para el dot blot arrojaría los siguientes resultados: sensibilidad 52,6%; especificidad 67,7%; valor predictivo positivo 35,7% y valor predictivo negativo 80,6%. Sin embargo, debido a las consideraciones referidas anteriormente, estos valores son meramente orientativos y no deberían constituir un criterio de evaluación de la calidad de los ensayos de PCR y dot blot.
Los resultados del presente trabajo ponen en evidencia la complejidad del panorama diagnóstico de las diarreas asociadas a C. difficile. La variación genética y la posibilidad de producción de proteínas modificadas y con diferentes actividades biológicas dan cuenta de una realidad epidemiológica en evolución. Asimismo, destacan la necesidad de profundizar los estudios, para adelantarse a los cambios evolutivos de este importante patógeno nosocomial, tanto en el aspecto diagnóstico como terapéutico.
En este contexto, las iniciativas de grupos nacionales para delinear métodos de diagnóstico diferentes de los disponibles en forma comercial permitirán aportar nuevas opciones que se adapten a las particularidades del sistema de salud de nuestro país.

Agradecimientos: el presente trabajo se realizó en el marco de proyectos de extensión e investigación de la Facultad de Ciencias Exactas (Secretaría de Extensión y Secretaría de Ciencia y Técnica). Los autores desean expresar su agradecimiento a los bacteriólogos y técnicos del Hospital de Emergencias Clemente Álvarez, quienes han contribuido a la recolección de muestras de materia fecal. Asimismo, la Dirección de Servicios de Laboratorios y Análisis Clínicos (D.S.L.A.C) y la Secretaría de Salud Pública de la Municipalidad de Rosario han brindado apoyo fundamental para la realización del presente proyecto. Especialmente, el grupo desea reconocer la labor del Dr. Eduardo Anchart, quien en todo momento avaló la continuidad de la colaboración entre los centros intervinientes. El Dr. Fernando M. Trejo es Becario posdoctoral del CONICET y el Dr. Pablo F. Pérez es Profesor Adjunto de la Facultad de Ciencias Exactas y miembro de la Carrera del Investigador Científico y Tecnológico del CONICET.

BIBLIOGRAFÍA

1. Alonso R, Muñoz C, Gros S, García de Viedma D, Peláez T, Bouza E. Rapid detection of toxigenic Clostridium difficile from stool samples by a nested PCR of toxin B gene. J Hosp Infect 1999; 41: 145-9.         [ Links ]

2. Baldacini O, Girardot R, Green GA, Rihn B, Monteil H. Comparative study of immunological properties and cytotoxic effects of Clostridium difficile toxin B and Clostridium sordellii toxin L. Toxicon 1992; 30: 129-40.         [ Links ]

3. Bouza E, Peláez T, Alonso R, Catalán P, Muñoz P, Rodríguez Créixems M. 'Second-look' cytotoxicity: an evaluation of culture plus cytotoxin assay of Clostridium difficile isolates in the laboratory diagnosis of CDAD. J Hosp Infect 2001; 48: 233-7.         [ Links ]

4. Boyce JM, Havill NL. Nosocomial antibiotic-associated diarrhea associated with enterotoxin-producing strains of methicillin-resistant Staphylococcus aureus. Am J Gastroenterol 2005; 100: 1828-34.         [ Links ]

5. Cohen SH, Tang YJ, Hansen B, Silva J Jr. Isolation of a toxin B-deficient mutant strain of Clostridium difficile in a case of recurrent C. difficile-associated diarrhea. Clin Infect Dis 1998; 26: 410-12.         [ Links ]

6. Depitre C, Delmee M, Avesani V, L'Haridon R, Roels A, Popoff M, et al. Serogroup F strains of Clostridium difficile produce toxin B but not toxin A. J Med Microbiol 1993; 38: 434-41.         [ Links ]

7. Gerding DN. Metronidazole for Clostridium difficile-associated disease: is it okay for Mom? Clin Infect Dis 2005; 40: 1598-600.         [ Links ]

8. Goorhuis A, Legaria MC, van den Berg RJ, Harmanus C, Klaassen CHW, Brazier JS, et al. Application of multiplelocus variable-number tandem-repeat analysis to determine clonal spread of toxin A-negative Clostridium difficile in a general hospital in Buenos Aires, Argentina. Clin Microbiol Infect 2009; 15: 1080-6.         [ Links ]

9. Guilbault C, Labbé AC, Poirier L, Busque L, Béliveau C, Laverdière M. Development and evaluation of a PCR method for detection of the Clostridium difficile toxin B gene in stool specimens. J Clin Microbiol 2002; 40: 2288-90.         [ Links ]

10. Högenauer C, Langner C, Beubler E, Lippe IT, Schicho R, Gorkiewicz G, et al. Klebsiella oxytoca as a causative organism of antibiotic-associated hemorrhagic colitis. N Engl J Med 2006; 355: 2418-26.         [ Links ]

11. Huelsenbeck J, Dreger S, Gerhard R, Barth H, Just I, Genth H. Difference in the cytotoxic effects of toxin B from Clostridium difficile strain VPI 10463 and toxin B from variant Clostridium difficile Strain 1470. Infect Immun 2007; 75: 801-9.         [ Links ]

12. Lyerly DM, Barroso LA, Wilkins TD, Depitre C, Corthier G. Characterization of a toxin A-negative, toxin B-positive strain of Clostridium difficile. Infect Immun 1992; 60: 4633-9.         [ Links ]

13. Lyerly DM, Sullivan NM, Wilkins TD. Enzyme-linked immunosorbent assay for Clostridium difficile toxin A. J Clin Microbiol 1983; 17: 72-8.         [ Links ]

14. Mallori Hooker RN. Clostridium difficile. Case analysis. Clin J Oncol Nursing 2007; 11: 800-4.         [ Links ]

15. Malnick SD, Zimhony O. Treatment of Clostridium difficile-associated diarrhea. Ann Pharmacotherapy 2002; 36: 1767-75.         [ Links ]

16. Martinez RD, Wilkins TD. Comparison of Clostridium sordellii toxins HT and LT with toxins A and B of C. difficile. J Clin Microbiol 1992; 36: 30-6.         [ Links ]

17. Minnaard J, Delfederico L, Vasseur V, Hollmann A, Rolny I, Semorile L, et al. Virulence of Bacillus cereus: a multivariate analysis. Int J Food Microbiol 2007; 116: 197-206.         [ Links ]

18. Mylonakis E, Ryan ET, Calderwood SB. Clostridium difficile-associated diarrhea: a review. Arch Int Med 2001; 161: 525-33.         [ Links ]

19. Norman F, Pérez-Molina J, de Ayala P. Clostridium difficile-associated diarrhea after antibiotic treatment for traveler's diarrhea. Clin Infect Dis 2008; 46: 1060-3.         [ Links ]

20. Peled N, Pitlik S, Samra Z, Kazakov A, Bloch Y, Bishara J. Predicting Clostridium difficile toxin in hospitalized patients with antibiotic-associated diarrhea. Infect Cont Hosp Epidemiol 2007; 28: 377-81.         [ Links ]

21. Pépin J, Valiquette L, Alary ME, Villemure P, Pelletier A, Forget K, et al. Clostridium difficile-associated diarrhea in a region of Quebec from 1991 to 2003: a changing pattern of disease severity. Can Med Assoc J 2004; 171: 466-72.         [ Links ]

22. Planche T, Aghaizu A, Holliman R, Riley P, Poloniecki J, Breathnach A, et al. Diagnosis of Clostridium difficile infection by toxin detection kits: a systematic review. Lancet Infect Dis 2008; 8: 777-84.         [ Links ]

23. Pothoulakis C, Lamont JT. Microbes and microbial toxins: paradigms for microbial-mucosal interactions II. The integrated response of the intestine to Clostridium difficile toxins. Am J Physiol Gastrointest Liver Physiol 2001; 280: 178-83.         [ Links ]

24. Poutanen SM, Simor AE. Clostridium difficile-associated diarrhea in adults. Can Med Assoc J 2004; 171: 51-8.         [ Links ]

25. Rupnik M. Heterogeneity of large clostridial toxins: importance of Clostridium difficile toxinotypes. FEMS Microbiol Rev 2008; 32: 541-55.         [ Links ]

26. Song HJ, Shim KN, Jung SA, Choi HJ, Lee MA, Ryu KH, et al. Antibiotic-associated diarrhea: candidate organisms other than Clostridium difficile. Korean J Intern Med 2008; 23: 9-15.         [ Links ]

27. Sunenshine RH, McDonald LC. Clostridium difficile-associated disease: new challenges from an established pathogen. Cleveland Clin J Med 2006; 73: 187-97.         [ Links ]

28. Ticehurst JR, Aird DZ, Dam LM, Borek AP, Hargrove JT, Carroll KC. Effective detection of toxigenic Clostridium difficile by a two-step algorithm including tests for antigen and cytotoxin. J Clin Microbiol 2006; 44: 1145-9.         [ Links ]

29. Trejo FM, Pérez PF, De Antoni GL. Co-culture with potentially probiotic microorganisms antagonizes virulence factors of Clostridium difficile in vivo. Antonie van Leeuwenhoek 2010; 98: 19-29.         [ Links ]

30. van den Berg RJ, Bruijnesteijn van Coppenraet LS, Gerritsen HJ, Endtz HP, van der Vorm ER, Kuijper EJ. Prospective multicenter evaluation of a new immunoassay and real-time PCR for rapid diagnosis of Clostridium difficile-associated diarrhea in hospitalized patients. J Clin Microbiol 2005; 43: 5338-40.         [ Links ]

31. Walker RC, Ruane PJ, Rosenblatt JE, Lyerly DM, Gleaves CA, Smith TF. Comparison of culture, cytotoxicity assays, and enzyme-linked immunosorbent assay for toxin A and toxin B in the diagnosis of Clostridium difficile-related enteric disease. Diagn Microbiol Infect Dis 1986; 5: 61-9.         [ Links ]

32. Wilkins TD, Lyerly D.M. Clostridium difficile testing: after 20 years, still challenging. J Clin Microbiol 2003; 41: 531-4.         [ Links ]

Recibido 23/03/10
Aceptado: 23/07/10