SciELO - Scientific Electronic Library Online

 
vol.43 número3Y finalmente... la Revista Argentina de Microbiología impactóSpecies distribution and susceptibility profile of yeasts isolated from blood cultures: results of a multicenter active laboratory-based surveillance study in Argentina índice de autoresíndice de materiabúsqueda de artículos
Home Pagelista alfabética de revistas  

Servicios Personalizados

Articulo

Indicadores

  • No hay articulos citadosCitado por SciELO

Links relacionados

  • En proceso de indezaciónCitado por Google
  • No hay articulos similaresSimilares en SciELO
  • En proceso de indezaciónSimilares en Google

Bookmark


Revista argentina de microbiología

versión impresa ISSN 0325-7541

Rev. argent. microbiol. vol.43 no.3 Ciudad Autónoma de Buenos Aires jun./set. 2011

 

ARTÍCULO ORIGINAL

Evaluación de los sistemas comerciales automatizados VITEK 2 y API 20NE para la identificación de organismos del complejo Burkholderia cepacia aislados de muestras clínicas

 

Sebastián Oderiz1, María J. Palau1, Paula Del Palacio1, Miriam C. Lewis1, Marisa P. Bettiol1, Pablo Martina2, Alejandra Bosch2, Osvaldo M. Yantorno2, Blanca M. Gatti1*

1Sala de Microbiologí  HIAEP "Sor María Ludovica", Calle 14 N° 1631, La Plata;
2Centro de Investigación y Desarrollo de Fermentaciones Industriales (CINDEFI, CONICET), Facultad de Ciencias Exactas, UNLP, Calle 47 y 115, La Plata. Argentina.

*Correspondencia. E-mail: microbiologialudovica@gmail.com

 


RESUMEN

Las especies del complejo Burkholderia cepacia (CBC) son capaces de causar infecciones crónicas del tracto respiratorio en pacientes con fibrosis quística y en otros individuos inmunocomprometidos. La mayoría de estas especies exhiben alta resistencia a la terapia antibiótica, lo que genera la necesidad de una detección rápida y precisa para poder implementar estrategias de control adecuadas. En este trabajo se utilizó la técnica de reacción en cadena de la polimerasa (PCR) para amplificar el gen recA (PCR-recA), con el fin de identificar microorganismos pertenecientes al CBC. Con este método molecular como referencia, se evaluó la sensibilidad (S) y la especificidad (E) de dos sistemas de identificación comerciales automatizados, VITEK 2 y API 20NE (bioMérieux®), así como también el valor de las pruebas bioquímicas manuales más representativas para la identificación de estos microorganismos. El método VITEK 2 presentó una S del 71,1 % y una E del 100 %; para el método API 20NE, estos valores fueron 69,7 % y 90,2 %, respectivamente. En cuanto a las pruebas fenotípicas manuales, los resultados obtenidos fueron más heterogéneos, lo que posiblemente se deba a que estas bacterias podrían sufrir presión selectiva para sobrevivir en pacientes crónicos y perder factores fenotípicos característicos. La técnica de PCR-recA resultó de fácil implementación, por lo que cabe considerar a esta técnica de identificación como una opción viable, aun en laboratorios de diagnóstico clínico de mediana complejidad.

Palabras clave: Complejo Burkholderia cepacia; Fibrosis quística; PCR; gen recA; VITEK 2 compact; API 20NE.

ABSTRACT

Evaluation of commercial systems VITEK 2 and API 20NE for identification of Burkholderia cepacia complex bacteria from clinical samples. Species belonging to the Burkholderia cepacia complex (BCC) are capable of causing chronic respiratory tract infections in patients suffering from cystic fibrosis as wel as in immunocompromised individuals.
Most of these species are highly resistant to antibiotic therapy, generating the need for their rapid and accurate detection for the proper treatment and clinical management of these patients. In this wok, the polymerase chain reaction (PCR) technique based on the amplification of the recA gene (PCR-recA) was applied for an accurate identification of bacteria belonging to the BCC. Sensitivity (S) and specificity (E) of two biochemically-based commercial automated systems, API 20NE and VITEK 2 (bioMérieux®), and of the most representative biochemical manual tests for the identification of the Burkholderia cepacia complex were herein evaluated. The commercial systems VITEK 2 and API 20NE showed the following sensitivity and specificity vaues for identification to the species level, S: 71.1 %, E: 100 %, S: 69.7 %, E: 90.2 %, respectively. More complex results were observed for phenotypic manual tests, since BCC bacteria can undergo selective pressure to survive in chronic patients causing the loss of their typical phenotypic characteristics.
The PCR-recA technique was easy to implement even in medium-complexity clinical diagnostic laboratories.

Key words: Burkholderia cepacia complex; Cystic fibrosis; PCR; RecA gene; VITEK2 compact; API 20NE.


 

INTRODUCCIÓN

Burkholderia representa un importante género bacteriano constituido por más de 60 especies de interés en el campo de la ecología, la biotecnología y la clínica. La mayoría de estas especies se encuentran en ambientes naturales y no suelen ser patógenos para los humanos sanos (23). Sin embargo, los organismos incluidos en el complejo Burkholderia cepacia (CBC) son capaces de causar infecciones crónicas y frecuentemente graves en el tracto respiratorio de pacientes con fibrosis quística (FQ) (21). Algunos miembros  de este complejo han emergido como patógenos oportunistas en pacientes inmunocomprometidos, en los que causan una variedad de infecciones como bacteriemia, infección del tracto urinario, artritis séptica y neumonía (19).
La taxonomía del CBC es sumamente compleja y se encuentra en permanente revisión (7, 23). Desde el año 2009, cuando Vanlaere et al. (30) describieron el taxón K, este complejo está integrado por 17 especies: Burkholderia cepacia (3, 28), Burkholderia multivorans (28), Burkholderia cenocepacia (27, 28), Burkholderia stabilis (28, 29), Burkholderia vietnamiensis (10, 28), Burkholderia dolosa (5, 32), Burkholderia ambifaria (6), Burkholderia anthina (26), Burkholderia pyrrocinia (26), Burkholderia ubonensis (31, 33), Burkholderia latens (31), Burkholderia diffusa (31), Burkholderia arboris (31), Burkholderia seminalis (31), Burkholderia metallica (31), Burkholderia contaminans (30) y Burkholderia lata (30).
Estas especies se encuentran estrechamente relacionadas tanto en términos genéticos como fenotípicos (20), de modo que resulta difícil diferenciarlas. La identificación definitiva se debe realizar por técnicas de biología molecular (22). Si bien todas las especies del CBC han sido aisladas de muestras clínicas (20), B. multivorans y B. cenocepacia son las de mayor incidencia a nivel mundial y dan cuenta de la mayoría de los episodios de diseminación epidémica en pacientes con FQ y sin ella (8, 11, 18, 20). Algunos estudios recientes revelan que en la Argentina existe una epidemiología local particular, con alta prevalencia de B. contaminans (9, 15, 24). Los pacientes con FQ infectados por organismos del CBC presentan elevados niveles de bacterias en el fluido salival, lo que indica la alta posibilidad de transmisión indirecta (17). Sin embargo, los índices de transmisión, el pronóstico y la mortalidad asociada son característicos de cada especie, al igual que lo son las estrategias terapéuticas (25).
Tanto el aislamiento como la identificación de estas bacterias son procedimientos engorrosos, y muchas veces los resultados de la identificación son ambiguos o erróneos como consecuencia de la similitud de estos organismos con otros posibles colonizadores pulmonares, como Pandoraea spp., Ralstonia spp. y otros organismos gram negativos multirresistentes (7, 34). La identificación de microorganismos del CBC es, por lo tanto, una tarea laboriosa y compleja, que demanda a los laboratorios contar con personal altamente entrenado. Además, los miembros del CBC son muy resistentes a la terapia con antibióticos, lo que dificulta el tratamiento (23). Por este motivo, la precisión y rapidez en la detección son esenciales para evaluar el riesgo, el pronóstico y la epidemiología de las infecciones en pacientes con fibrosis quística, y también para tomar las medidas preventivas y terapéuticas más adecuadas (12).
Nuestro objetivo fue comparar la confiabilidad y sensibilidad de los sistemas comerciales API 20NE y VITEK 2 compact automatizado (bioMérieux, Marcy l'Etoile, Francia) y de las técnicas bioquímicas manuales para la identificación de Burkholderia spp. aisladas de muestras clínicas, empleando la amplificación del gen recA como método de identificación de referencia.

MATERIALES Y MÉTODOS

Microorganismos, aislamientos y cultivos

Se analizó un total de 95 aislados de diferentes géneros y especies de bacilos gram negativos no fermentadores (BGN-NF) obtenidos de muestras clínicas recuperadas de pacientes atendidos en el Hospital Interzonal de Agudos Especializado en Pediatría (HIAEP) "Sor María Ludovica" durante el período 2004-2010, al que se sumaron 18 cepas de referencia.
Las cepas de referencia fueron las siguientes: Inquilinus limosus (DSM 16000), Pandoraea apista (DSM 16535), Pandoraea pnomenusa (DSM 16536), Pandoraea pulmonicola (DSM 16583), Ralstonia pickettii (DSM 6297), Burkholderia gladioli (DSM 4285), B. cepacia (PM143), B. cepacia (PM185), B. cenocepacia (PM3), B. multivorans (ATCC 17616), B. multivorans (PM407), B. stabilis (LMG 18870), B. contaminans (PM405), B. contaminans (PM151), B. vietnamiensis (PM48), B. ambifaria (DSM 16087), B. dolosa (DSM 16088) y B. pyrrocinia (DSM 10685). Estas cepas, que habían sido adquiridas en ceparios internacionales, se obtuvieron del Centro de Investigación y Desarrollo de Fermentaciones Industriales de la Facultad de Ciencias Exactas de la Universidad de La Plata (CINDEFI, UNLP). Todas estas cepas y los aislados clínicos fueron identificados por secuenciación del gen recA (1, 24).
Entre los aislados clínicos se incluyeron 43 microorganismos pertenecientes al CBC y 52 cepas de otros BGNNF (no-CBC) relacionados, todos provenientes del banco de cepas del citado hospital. A continuación se detalla la distribución de estos últimos (entre paréntesis se indica el número de aislamientos evaluados en cada caso): Achromobacter piechaudii (1), Achromobacter xylosoxidans (8), Achromobacter denitrificans (1), complejo Acinetobacter baumannii-calcoaceticus (2), Rhizobium radiobacter (1), Bordetella bronchiseptica (1), Chryseobacterium gleum-indologenes (1), B. gladioli (1), Elizabethkingia meningoseptica (2), Pseudomonas aeruginosa (2), Pseudomonas putida (2), Pseudomonas stutzeri (1), R. pickettii (1 y  Stenotrophomonas maltophilia (4). Los 24 microorganismos restantes eran BGNNF aislados de muestras respiratorias de pacientes con FQ, que no fueron identificados a nivel de género y especie.
Todos los aislados y las cepas de referencia se conservaron hasta su análisis en el banco de cepas del Servicio de Microbiología del mencionado nosocomio, a -70 °C en leche descremada estéril al 4 %. Antes del procesamiento para evaluar las distintas técnicas, los cultivos conservados fueron descongelados y estriados sobre agar Columbia con 5 % de sangre de carnero (bioMérieux) e incubados a 35 °C durante 24 a 48 horas. Las colonias aisladas de los cultivos fueron sembradas en agar hierro triple azúcar (Britania, Buenos Aires, Argentina), para comprobar la característica de organismo no fermentador de azúcares, y en agar Mueller-Hinton (Britania) con una incubación de 18-24 horas a 35 °C, para realizar las distintas técnicas de identificación.
Con respecto a la identificación empleando los sistemas automatizados, 74 fueron las cepas analizadas por VITEK2 [(37 aislamientos del CBC, uno de B. dolosa DSM 16088, 32 aislamientos no-CBC y las cepas de referencia P. apista DSM 16535, P. pnomenusa DSM 16536, P. pulmonicola DSM 16583 y R. pickettii DSM 6297; (Tabla 1)] y 73 los aislados analizados por API 20E [(33 del CBC y 40 no pertenecientes al CBC; (Tabla 2)]. Solo 47 aislamientos (27 CBC y 20 no-CBC) fueron analizados por ambos sistemas comerciales (Tablas 1 y 2), y 35 aislamientos clínicos del CBC fueron caracterizados mediante pruebas bioquímicas convencionales (Tabla 3).

Tabla 1. Evaluación del sistema VITEK 2 usando como identificación de referencia para el complejo Burkholderia cepacia la amplificación del gen recA

Abreviaturas: E, excelente; VG, muy buena; G, buena; A, aceptable; LD, baja discriminación. (1)Incluye la cepa B. dolosa DSM 16088; (2)Pandoraea apista DSM 16535 y Pandoraea pnomenusa DSM 16536; (3)Ralstonia pickettii DSM 6297; (4)Incluye Pandoraea pulmonicola DSM 16583.

Tabla 2. Evaluación del sistema API 20NE usando como identificación de referencia para el complejo Burkholderia cepacia la amplificación del gen recA

Abreviaturas: E, excelente; MB, muy buena; MBG, muy buena ID de género; B, buena; BG, buena ID de género; A, aceptable; BD, baja discriminación; D, dudosa; I, inaceptable, V, variable.

Tabla 3. Pruebas bioquímicas para aislados clínicos identificados como pertenecientes al complejo Burkholderia cepacia empleando la técnica de amplificación del gen recA como referencia

(1)Método de difusión en agar con discos según normas CLSI para P. aeruginosa

Extracción de ADN

Un inóculo apropiado de las colonias desarrolladas en medio sólido se suspendió en 100 µl de solución de tritón X-100 al 1 % (Merck, Alemania) en buffer TE 1X (turbidez aproximadamente equivalente a la del tubo N.° 2 de la escala de McFarland). Luego de hervir en baño de agua durante 15 min, las muestras se centrifugaron a 10 000 rpm durante 10 min. Se tomaron 5 µl del sobrenadante y se le adicionaron 95 µl de agua tridestilada. Esta dilución (templado) se conservó a -20 °C para ser utilizada como molde en la reacción de PCR.

Identificación molecular

Para la identificación genotípica se procedió a la amplificación del gen recA (1043 pb) por PCR descrita por Mahenthiralingam et al. (22), utilizando los cebadores específicos para el CBC, es decir, BCR1 (TGACCGCCGAGAAGAGCAA) y BCR2 (CTCTTCTTCGTCCATCGCCTC). Brevemente, se emplearon 25 µl de volumen final de reacción que contenían 5 µl de buffer Green Go 5X (concentración final de MgCl2 1,5 mM), 125 μM de cada dNTP (Invitrogen Life Technologies, Brasil), 0,4 μmoles de cada oligonucleótido (Invitrogen), 1 U de Taq polimerasa (Invitrogen) y 5 μl de ADN templado. Como control positivo se utilizó ADN extraído de una cepa de referencia de B. multivorans (ATCC 17616); como control negativo se empleó agua destilada.
La amplificación se realizó en un termociclador Eppendorf Master Cycler Personal (Eppendorf, Alemania) bajo las siguientes condiciones: desnaturalización inicial a 94 °C-120 s; 30 ciclos a 94 °C-45 s, 58 °C-60 s y 72 °C-120 s; y extensión final a 72 °C-10 min. Los productos de PCR de 1040 pb se resolvieron en gel de agarosa al 2 % en buffer TAE 1X adicionado de 0,5 µg/ml de bromuro de etidio (Promega, Madison, WI, EE.UU.). Se realizó la corrida electroforética a 10 V/cm durante 40 min. Como marcador de peso molecular se utilizó 100 bp Molecular Rule (BioRad, Hercules, CA, EE.UU.). Se fotodocumentó con sistema de adquisición de imagen  BioRad (modelo 2000) y el sistema Kodak Digital Science DC 120 (Eastman Kodak Company, Rochester, NY, EE.UU.).

Identificación con el sistema VITEK 2 compact

Se siguieron estrictamente los procedimientos recomendados por el fabricante. Se ajustó la suspensión bacteriana al estándar 0,6 de McFarland (rango 0,50-0,63) en 2,5 ml de solución de NaCl al 0,45 % con un densitómetro (bioMérieux). El tiempo entre la preparación de la suspensión y el llenado de la tarjeta fue inferior a 30 min. Para el control de calidad, se ensayaron semanalmente y en cada procesamiento de un lote nuevo de reactivos cinco cepas de referencia, Escherichia coli ATCC 25922, Klebsiella pneumoniae ATCC 700603, P. aeruginosa ATCC 27853, Staphylococcus aureus ATCC 29213 y Enterococcus faecalis ATCC 29212. Los análisis se realizaron usando la tarjeta de VITEK 2 ID-GN.
Para valorar la calidad de la identificación se tuvo en cuenta el porcentaje de probabilidad (ID %) que arrojó el sistema VITEK 2 compact. Dicho parámetro representa el nivel de comparación entre las reacciones observadas y las reacciones habituales de cada organismo. Mediante el empleo de este parámetro, los resultados de la identificación pudieron expresarse acompañados de un indicador de su calidad. Se calificó como ID excelente (E), ID muy buena (VG), ID buena (G) e ID aceptable (A) cuando los valores de concordancia fueron de 96-99 %, 93-95 %, 89-92 % y 85-88 %, respectivamente, y como ID de baja discriminación (LD) cuando el sistema suministró más de un resultado de identificación (con lo cual el software sugiere la realización de pruebas adicionales). El sistema también prevé la categoría ID no definido o inconcluso (U).

Identificación con el sistema API 20NE

Se utilizó el sistema comercial API 20NE siguiendo las instrucciones del fabricante. La incubación se realizó durante 24 a 48 horas en aire a 37 °C. Luego de la lectura de las reacciones producidas, espontáneas o reveladas mediante la adición de reactivos, se llevó a cabo el registro manual de los datos para su posterior incorporación al software APIWEB (bioMérieux). Los resultados obtenidos fueron informados de acuerdo a los criterios establecidos por el fabricante, considerando un resultado como válido cuando el porcentaje de identificación fue de al menos 90 %. Los resultados de identificación se clasificaron en las siguientes categorías de calidad: excelente (E), muy buena (MB), muy buena ID de género (MBG), buena (B), buena ID de género (BG), aceptable (A), baja discriminación (BD), dudosa (D) e inaceptable (I).

Identificación con pruebas  bioquímicas convencionales

Se observó la producción de pigmento en agar Mueller-Hinton (Britania), la movilidad (por observación microscópica en fresco de un cultivo en caldo BHI en fase logarítmica) y se efectuó la prueba de la oxidasa. Esta se realizó con tiras impregnadas con una solución acuosa al 0,5 % de clorhidrato de tetrametil-p-fenilendiamina. La oxidación de azúcares se observó en el medio OF de Hugh y Leifson suplementado con 1 % de glucosa, xilosa, manitol y lactosa. Se efectuaron también las siguientes pruebas: lisina descarboxilasa (LDC), esculina, DNasa y ONPG. Todas las incubaciones se realizaron a 37 °C en aire ambiente, a excepción de las requeridas para las pruebas de DNasa, de producción de pigmento y de movilidad, que se incubaron a 25-28 °C y se prolongaron durante 7 días (oxidación de azúcares y producción de pigmento), 5 días (LDC e hidrólisis de esculina) y 2 días (ONPG y DNasa). La sensibilidad a la gentamicina y a la colistina fue determinada por difusión con discos de 15 µg y 10 µg de ambas drogas en agar Mueller-Hinton, según el método de Kirby-Bauer, utilizando los puntos de corte para Pseudomonas aeruginosa, Clinical and Laboratory Standards Institute (CLSI) (4).

Sensibilidad y especificidad

El cálculo de la sensibilidad (S) y la especificidad (E) se realizó utilizando una tabla de contingencia (14). Se compararon los resultados obtenidos con los sistemas comerciales respecto de los observados mediante la amplificación del gen recA por PCR. Con relación a este último; se consideró como perteneciente al CBC a todo aislamiento que produjo una señal positiva para el gen recA. El valor de S se basa en la relación a/(a + c), donde a representa el número de cepas que fueron correctamente identificadas como pertenecientes al CBC (positivos verdaderos) y c representa el número de cepas del CBC incorrectamente identificadas como no-CBC (falsos negativos). El valor de E se basa en la relació d/ (b + d), donde d es el número de aislamientos correctamente identificados por el método de estudio como no-CBC (verdaderos negativos) y b es el número de cepas que fueron incorrectamente identificadas como pertenecientes al CBC (falsos positivos).

Análisis estadístico

Los intervalos de confianza (IC) para S y E fueron calculados mediante el programa SPSS® 15.0 para Windows (http://www.spss.com/es), con un 95 % de confianza.

Resultados

Se estudiaron mediante la amplificación del gen recA 18 cepas de referencia y 95 cepas clínicas (43 pertenecientes al CBC y 52 BGNNF relacionados) provenientes del banco de cepas del Hospital de Niños "Sor María Ludovica". Los resultados de identificación dentro del CBC fueron concordantes con la asignación previa de las correspondientes cepas estudiadas; todos los organismos pertenecientes al complejo que fueron analizados revelaron un amplicón de 1043 pb. En la Figura 1 se muestra, a modo de ejemplo, la amplificación obtenida para varias de las cepas de referencia pertenecientes al CBC y para dos aislados clínicos seleccionados.


Figura 1
. Amplificación del gen recA por PCR. 1: B. contaminans (PM405), 2: B. multivorans (PM407), 3: B. cenocepacia (PM3), 4: B. vietnamiensis (PM48), 5: B. cepacia (PM143), 6: B. multivorans (ATCC17616), 7: aislamiento clínico (FQ8820), 8: aislamiento clínico (FQ8833), 9: B. contaminans (PM151), 10: B. stabilis (LMG18870), 11: B. ambifaria (DSM16087), 12: control negativo, 13: B. dolosa (DSM16088), 14: B. cepacia (PM185), 15: marcador de peso molecular.

Noventa y cinco aislamientos clínicos y 5 cepas de referencia se analizaron por PCR-recA y paralelamente por VITEK 2 y/o API 20NE, a fin de evaluar la sensibilidad y confiabilidad de dichos sistemas de identificación. La Tabla 1 muestra los porcentajes de probabilidad o ID % y la calidad de la identificación obtenida empleando el sistema comercial VITEK 2 en 37 aislados clínios identificados como pertenecientes al CBC por amplificación del gen recA, más una cepa de referencia (B. dolosa DSM 16088), y en 32 aislados clínicos de BGNNF más 4 cepas de referencia (P. apista DSM 16535, P. pnomenusa DSM 16536, P. pulmonicola DSM 16583 y R. pickettii DSM 6297) que no amplificaron con los cebadores del gen recA específicos del CBC (no-CBC).
Siete aislados clínicos CBC positivos (9,4 % del total de aislamientos evaluados por ambos métodos) fueron identificados erróneamente por VITEK 2 como P. aeruginosa (en 4 oportunidades), como complejo A. baumanniicalcoaceticus (en 2 casos) y como Aeromonas sobria (en 1 caso), con calidad de VG, G o A. Cuatro aislados clínicos CBC positivos (5,4 % del mismo total)  fueron identificados en la categoría LD, y en este último grupo el sistema arrojó como opciones de ID % otras especies de BGNNF, entre ellas P. aeruginosa, pero no incluyó al CBC dentro de esas opciones. La identificación por el sistema automatizado VITEK 2 compact presentó una S de 71,1  % (IC = 56,6; 85,5 %) y una E de 100 %.
En cuanto a la identificación empleando el sistema API 20NE, la Tabla 2 muestra los % de ID probables y la calidad de ID de 33 aislados clínicos CBC positivos por amplificación del recA y de 40 aislados CBC negativos. A diferencia del método arriba descrito, este método de identificación arrojó 4 falso-positivos, correspondientes a 4 aislamientos CBC negativos (5,4 % del total de aislamientos evaluados por estos dos métodos) que fueron identificados por API 20NE como B. cepacia, y 10 aislados clínicos CBC positivos (es decir, el 13,7 % del total evaluado por ambos métodos) que no pudieron ser identificados.
Dos de ellos incluían CBC entre varias opciones, pero con calidad de identificación inaceptable y sin sugerir pruebas adicionales. Asimismo, 2 aislados CBC positivos (2,7 % del mismo total) fueron identificados erróneamente como Moraxella sp. y Chryseobacterium sp., con calidad de identificación aceptable y con porcentajes menores del 90 %. El sistema API 20NE arrojó para las 73 muestras analizadas valores promedio de S del 69,7 %, (IC = 54; 85,4 %) y de E del 90,2 % (IC = 81,2; 99,3 %).
La Tabla 3 muestra las principales características fenotípicas (pruebas bioquímicas, movilidad y pigmentación) observadas en 35 aislados clínicos CBC positivos de acuerdo con los resultados de amplificación del gen recA.

DISCUSIÓN

La identificación por métodos fenotípicos de bacterias pertenecientes al CBC y su diferenciación de otros géneros del grupo de los BGNNF es dificultosa y requiere la combinación de varios ensayos, entre estos el uso de medios de cultivo selectivos, la realización de pruebas bioquímicas y la aplicación de sistemas comerciales automatizados (2, 8, 10). Los métodos bioquímicos automatizados han sido motivo de constante actualización en los últimos años y han demostrado un progresivo aumento en el nivel de certeza en la identificación. Sin embargo, las herramientas moleculares siguen constituyendo las últimas estrategias de elección para una identificación confiable y precisa. En este trabajo se aplicó un ensayo de PCR utilizando los cebadores BCR1 y BCR2 para la amplificación del gen recA, con el objeto de identificar organismos pertenecientes al CBC (19). En concordancia con lo ya publicado, esta técnica mostró un 100 % de confiabilidad para la identificación de organismos pertenecientes al CBC y la discriminación de otros BGNNF con características similares. Aunque solo se incluyeron 2 aislamientos de B. gladioli, la PCR-recA también mostró su capacidad para diferenciar a esta especie (de fenotipo similar, pero no perteneciente filogenéticamente al CBC), en concordancia con lo demostrado por Mahenthiralingam et al. (22). Es importante destacar que la implementación de la metodología molecular, tal como se detalla en este trabajo, podría llevarse a cabo en laboratorios microbiológicos hospitalarios de complejidad relativamente baja. Sin embargo, dado que en la actualidad es común en la gran mayoría de los laboratorios hospitalarios nacionales el empleo de los sistemas de identificación comerciales, como VITEK 2 y API 20NE, se decidió estudiar los niveles relativos de precisión de estos sistemas para la identificación de aislados clínicos pertenecientes al CBC.
Los resultados obtenidos con el sistema VITEK 2 compact demuestran que dicho método constituye una herramienta confiable en la identificación de or ganismos pertenecientes al CBC, ya que no mostró resultados falso-positivos (Tabla 1). Sin embargo, ante la sospecha de un BGNNF con características de CBC, se debe tener en cuenta la posibilidad de falso-negativos que pueden requerir pruebas adicionales para su identificación.
Nuestros resultados, basados en el análisis de 33 aislados clínicos CBC positivos y 40 aislados clínicos CBC negativos, demostraron que el sistema de identificación API 20NE no resulta ser un sistema confiable para el reconocimiento de organismos del CBC, por lo que sus resultados deberían ser tomados con precaución.
La caracterización fenotípica de las especies del CBC es dificultosa, aun con un panel extendido de pruebas bioquímicas manuales (16). Ante un BGNNF oxidasa positivo de reacción lenta, DNasa negativo y que oxida la glucosa, el manitol y descarboxila la lisina, debemos pensar en la asignación de dicho aislado a un organismo miembro del CBC. Es fundamental tener en cuenta que S. maltophilia puede utilizar glucosa y lisina y, ocasionalmente, dar una débil o lenta reacción de oxidasa, pero la prueba de DNasa en general es positiva dentro de las 48 horas; además, no oxida el manitol.
La prueba de oxidasa presentó una positividad del 100 %, aunque normalmente en los aislados del CBC esta reacción es lenta (ocurre entre los 10 y los 60 segundos). Esto ayuda a diferenciarlos de especies muy relacionadas como Ralstonia y Cupriavidus, que responden a esta prueba de manera muy rápida (dentro de los 10 segundos).
Es conocida la resistencia natural de organismos del CBC a las polimixinas y a la gentamicina (8, 12). Todas las cepas del CBC fueron resistentes a ambos antibióticos al ser analizadas por VITEK 2 (datos no mostrados). Sin embargo, el método de difusión según el CLSI puede aparentar sensibilidad en algunos casos y llevarnos a conclusiones erróneas.
Hemos advertido que el ensayo de movilidad debe realizarse a partir de un cultivo fresco (de 24 h), puesto que las cepas pierden viabilidad rápidamente. Aunque la bibliografía indica que todas las cepas del CBC son móviles (12), nosotros encontramos en los aislados clínicos evaluados un porcentaje de positividad de 91 %. La presencia de pigmento amarillo está descrita como una característica de identidad del CBC, pero en general esto se observa en cepas provenientes de plantas y de suelo, mientras que las cepas de origen clínico suelen ser no pigmentadas (12). El pigmento se observó en el 40 % de las cepas del CBC estudiadas. Este porcentaje relativamente alto podría deberse a la alta prevalencia de B. contaminans en nuestro país (15, 24), que a menudo presenta pigmento amarillo (30). Otra característica de B. contaminans, inusual entre otras especies del CBC, es la capacidad de hemólisis (30), que se halló en el 57 % de nuestras cepas. La prueba de LDC es positiva en la mayoría de los miembros del complejo, excepto en B. dolosa, de muy baja frecuencia mundial (http://pubmlst.org), y en aproximadamente la mitad de los aislamientos de B. multivorans (12), de modo que una prueba de LDC negativa no descarta la posibilidad de estar frente a uno de estos organismos. Además, el inóculo inicial debe ser alto para evitar resultados falso-negativos. Lo mismo ocurre con la prueba de ONPG, que es negativa para los aislamientos de B. stabilis (13). Las pruebas de oxidación de azúcares (manitol, xilosa, lactosa y glucosa) presentaron altos porcentajes de positividad tras 7 días de incubación, tal como se menciona en la bibliografía (8, 12, 13); solo la prueba de oxidación de glucosa mostró un 100 % de positividad.
La caracterización fenotípica de los organismos pertenecientes al CBC es compleja, dado que es un grupo heterogéneo y de difícil crecimiento. Sumado a esto, se debe tener presente que los integrantes del CBC pueden sufrir presión selectiva para sobrevivir en los pacientes. Esto resulta en la pérdida de factores fenotípicos característicos (8, 12) y genera la necesidad de desarrollar métodos moleculares, como el utilizado en este trabajo, que puedan ser llevados a cabo fácilmente en los laboratorios clínicos.

Agradecimientos: los autores agradecen a los Dres. Horacio Lopardo y Rolando Soloaga por la revisión del manuscrito y sus valiosos aportes.

BIBLIOGRAFÍA

1. Bosch A, Miñán A, Vescina C, Degrossi J, Gatti B, Montanaro P, Messina M, Franco M, Vay C, Schmitt J, Naumann D, Yantorno O. Fourier transform infrared spectroscopy for rapid identification of nonfermenting gram-negative bacteria isolated from sputum samples from cystic fibrosis patients. J Clin Microbiol 2008; 46: 2535-46.         [ Links ]

2. Brisse S, Stefani S, Verhoef J, Van Belkum A, Vandamme P, Goessens W. Comparative evaluation of the BD Phoenix and VITEK 2 automated instruments for identification of isolates of the Burkholderia cepacia complex. J Clin Microbiol 2002; 40: 1743-8.         [ Links ]

3. Burkholder WH. Sour skin, a bacterial rot of onion bulbs. Phytopathology 1950; 40: 115-8.         [ Links ]

4. Clinical and Laboratory Standards Institute. Performance standards for antimicrobial susceptibility testing; 18th informational supplement, 2009; M100-S19. Wayne, Pa, EE.UU.         [ Links ]

5. Coenye T, Laevens S, Willems A, Ohlen M, Hannant W, Govan JR. Burkholderia fungorum sp. nov. and Burkholderia caledonica sp. nov., two new species isolated from the environment, animals and human clinical samples. Int J Syst Evol Microbiol 2001; 51: 1099-107.         [ Links ]

6. Coenye T, Mahenthiralingam E, Henry D, LiPuma JJ, Laevens S, Gillis M. Burkholderia ambifaria sp. nov., a novel member of the Burkholderia cepacia complex including biocontrol and cystic fibrosis-related isolates. Int J Syst Evol Microbiol 2001; 51: 1481-90.         [ Links ]

7. Coenye T, Vandamme P, Govan JR, LiPuma JJ. Taxonomy and identification of the Burkholderia cepacia complex. J Clin Microbiol 2001; 39: 3427-36.         [ Links ]

8. Drevinek P, Mahenthiralingam E. Burkholderia cenocepacia in cystic fibrosis: epidemiology and molecular mechanisms of virulence. Clin Microbiol Infect Rev 2010; 7: 821-30.         [ Links ]

9. Galanternik L. Burkholderia cepacia: el camino recorrido desde el año 2000. XII Congreso Argentino de Microbiología, 2010, p. 6, Ciudad Autónoma de Buenos Aires, Argentina.         [ Links ]

10. Gillis M, Van TV, Bardin R, Goor M, Hebbar P, Willems A. Polyphasic taxonomy in the genus Burkholderia leading to an emended description of the genus and proposition of Burkholderia vietnamiensis sp. nov. for N2-fixing isolates from rice in Vietnam. Int J Syst Bacteriol 1995; 45: 274.         [ Links ]

11. Hauser AR, Manu J, Bar-Meir M, McColley SA. Clinical significance of microbial infection and adaptation in cystic fibrosis. Clin Microbiol Rev 2011; 24: 29-70.         [ Links ]

12. Henry DA, Campbell ME, LiPuma JJ, Speert DP. Identification of Burkholderia cepacia isolates from patients with cystic fibrosis and use of a simple new selective medium. J Clin Microbiol 1997; 35: 614-9.         [ Links ]

13. Henry DA, Mahenthiralingam E, Vandamme P, Coenye T, Speert DP. Phenotypic methods for determining genomovar status of the Burkholderia cepacia complex. J Clin Microbiol 2001; 39: 1073-8.         [ Links ]

14. Ilstrup DM. Statistical methods in microbiology. Clin Microbiol Rev 1990; 3: 219-26.         [ Links ]

15. Jordá-Vargas L, Degrossi J, Castañeda NC, D'Aquino M, Valvano MA, Procopio A, Galanternik L, Centrón D. Prevalence of indeterminate genetic species of Burkholderia cepacia complex in a cystic fibrosis center in Argentina. J Clin Microbiol 2008; 46: 1151-2.         [ Links ]

16. LiPuma JJ, Currie BJ, Lum GD, Vandamme PA. Burkholderia, Stenotrophomonas, Ralstonia, Cupriavidus, Pandoraea, Brevundimonas, Comamonas, Delftia, and Acidovorax. In: Murray PR, Baron EJ, Jorgensen JH, Landry ML, Pfaller MA, editors. Manual of Clinical Microbiology, 9th  edition. Washington, DC, ASM Press, 2007, p. 749-69.         [ Links ]

17. LiPuma JJ, Dulaney BJ, McMenamin JD, Whitby PW, Stull TL, Coenye T. Development of rRNA-based PCR assays for identification of Burkholderia cepacia complex isolates recovered from cystic fibrosis patients. J Clin Microbiol 1999; 37: 3167-70.         [ Links ]

18. LiPuma JJ, Spilker T, Gill LH, Campbell PW, Liu L, Mahenthiralingam E. Disproportionate distribution of Burkholderia cepacia complex species and transmissibility markers in cystic fibrosis. Am J Respir Crit Care Med 2001; 164: 92-6.         [ Links ]

19. LiPuma JJ. Burkholderia cepacia. Management issues and new insights. Clin Chest Med 1998; 19: 473-86, vi.         [ Links ]

20. LiPuma JJ. The changing microbial epidemiology in cystic fibrosis. Clin Microbiol Rev 2010; 23: 299-323.         [ Links ]

21. Mahenthiralingam E, Baldwin A, Vandamme P. Burkholderia cepacia complex infection in patients with cystic fibrosis. J Med Microbiol 2002; 51: 533-8.         [ Links ]

22. Mahenthiralingam E, Bischof J, Byrne SK, Radomski C, Davies JE, Av-Gay Y, Vandamme P. DNA-based diagnostic approaches for the identification of Burkholderia cepacia complex, Burkholderia vietnamiensis, Burkholderia multivorans, Burkholderia stabilis, and Burkholderia cepacia genomovars I and III. J Clin Microbiol 2000; 38: 3165-73.         [ Links ]

23. Mahenthiralingam E, Urban TA, Goldberg JB. The multifarious, multireplicon Burkholderia cepacia complex. Nat Rev Microbiol 2005; 3: 144-56.         [ Links ]

24. Miñán A, Bosch A, Lasch P, Stämmler M, Serra DO, Degrossi J, Gatti B, Vay C, D'aquino M, Yantorno O, Naumann D. Rapid identification of Burkholderia cepacia complex species including strains of the novel Taxon K, recovered from cystic fibrosis patients by intact cell MALDI-ToFmass spectrometry. Analyst 2009; 134: 1138-48.         [ Links ]

25. Soni R, Marks G, Henry DA, Robinson M, Moriarty C, Parsons S. Effect of Burkholderia cepacia infection in the clinical course of patients with cystic fibrosis: a pilot study in a Sydney clinic. Respirology 2002; 7: 241-5.         [ Links ]

26. Vandamme P, Henry D, Coenye T, Nzula S, Vancanneyt M, LiPuma JJ. Burkholderia anthina sp. nov. and Burkholderia pyrrocinia, two additional Burkholderia cepacia complex bacteria, may confound results of new molecular diagnostic tools. FEMS Immunol Med Microbiol 2002; 33: 143-9.         [ Links ]

27. Vandamme P, Holmes B, Coenye T, Goris J, Mahenthiralingam E, LiPuma JJ, Govan JR. Burkholderia cenocepacia sp. nov.-a new twist to an old story. Res Microbiol 2003; 154: 91-6.         [ Links ]

28. Vandamme P, Holmes B, Vancanneyt M, Coenye T, Hoste B, Coopman R. Occurrence of multiple genomovars of Burkholderia cepacia in cystic fibrosis patients and proposal of Burkholderia multivorans sp. nov. Int J Syst Bacteriol 1997; 47: 1188-200.         [ Links ]

29. Vandamme P, Mahenthiralingam E, Holmes B, Coenye T, Hoste B, DeVos P. Identification and population structure of Burkholderia stabilis sp. nov. (formerly Burkholderia cepacia genomovar IV). J Clin Microbiol 2000; 38: 1042-7.         [ Links ]

30. Vanlaere E, Baldwin A, Gevers D, Henry D, De Brandt E, LiPuma JJ. Taxon K, a complex within the Burkholderia cepacia complex, comprises at least two novel species, Burkholderia contaminans sp. nov. and Burkholderia lata sp. nov. Int J Syst Evol Microbiol 2009; 59: 102-11.         [ Links ]

31. Vanlaere E, LiPuma JJ, Baldwin A, Henry D, De Brandt E, Mahenthiralingam E. Burkholderia latens sp. nov., Burkholderia diffusa sp. nov., Burkholderia arboris sp. nov., Burkholderia seminalis sp. nov. and Burkholderia metallica sp. nov., novel species within the Burkholderia cepacia complex . Int J Syst Evol Microbiol 2008; 58: 1580-90.         [ Links ]

32. Vermis K, Brachkova M, Vandamme P, Nelis H. Isolation of Burkholderia cepacia complex genomovars from waters. Syst Appl Microbiol 2003; 26: 595-600.         [ Links ]

33. Yabuuchi E, Kawamura Y, Ezaki T, Ikedo M, Dejsirilert S, Fujiwara N, Naka T, Kobayashi K. Burkholderia uboniae sp. nov., L-arabinose-assimilating but different from Burkholderia thailandensis and Burkholderia vietnamiensis. Microbiol Immunol 2000; 44: 307-17.         [ Links ]

34. Zhou J, Garber E, Desai M, Saiman L. Compliance of clinical microbiology laboratories in the United States with current recommendations for processing respiratory tract specimens from patients with cystic fibrosis. J Clin Microbiol 2006; 44: 1547-9.         [ Links ]

Recibido: 26/04/11
Aceptado: 5/08/11