Ingeniería, Tecnología e Informática

Capacidades antagónicas de cepas Tríchoderma y su multiplicación en masa usando desechos agrícolas

Antagonistic capacities of Tríchoderma species and their mass multiplication with agricultural wastes

 

Marcela A. Sadañoski, Jimena Gutierrez-Brower, María L. Castrillo, Ana C. López, Paola A. Ojeda, Pedro D. Zapata, Laura L. Villalba, Mónica B. Otegui

Laboratorio de Biotecnología Molecular, Instituto de Biotecnología Misiones, CONICET, Facultad de Ciencias Exactas Químicas y Naturales, Universidad Nacional de Misiones, CP3300, Posadas, Misiones, Argentina.

* E-mail: biotecmol2010@gmail.com

---

Resumen

El objetivo de esta investigación fue aislar y caracterizar cepas de Tríchoderma nativas de Misiones (Argentina) explorando sus capacidades antagónicas y su multiplicación masiva utilizando diferentes residuos agroindustriales. Quince cepas nativas de Tríchoderma spp. fueron aisladas de muestras de suelo. Estos aislamientos se caracterizaron mediante observaciones morfológicas y moleculares basados en secuencias de ADN de la región espaciadora transcrita interna del ADNr. Las cepas de Tríchoderma spp. fueron identificadas como T. koningiopsis, T. harzianum, T. pleuroticola y T. brevicompactum. Estas cepas mostraron actividades antagónicas in vitro contra Alternaría sp., Fusaríum sp. y Botrytis sp.. T. koningiopsis LBM 090, LBM 091, LBM 092 y LBM 098, T. pleuroticola LBM 097 y T. harzianum LBM 096 presentaron una inhibición del crecimiento micelial mayor del 50% y un índice de antagonismo entre 3 y 4 contra los fitopatógenos ensayados. La cáscara de arroz y el pulido del arroz fueron las combinaciones más adecuadas para la multiplicación de T. harzianum LBM 096.

Palabras clave: Agentes de control biológico; Suelo; Hongos fitopatógenos; Cáscara de arroz; Pulido de arroz.

Abstract

The aim of this research was to isolate and characterize Tríchoderma native strains from Misiones (Argentina) exploring their antagonistic capacities to phytopatogens fungi and their mass multiplication using different agricultural wastes. Fifteen native strains of Tríchoderma spp. were isolated from soil samples. These isolates were characterized via morphological observations and molecular phylogenetic analysis based on DNA sequences of the rDNA internal transcribed spacer region. The Tríchoderma native strains were identified as T. koningiopsis, T. harzianum, T. pleuroticola and T. brevicompactum. All strains showed antagonistic activities in vitro against Alternaría sp., Fusaríum sp. and Botrytis sp. T. koningiopsis LBM 090, LBM 091, LBM 092, and LBM 098 strains, T. pleuroticola LBM 097 and T. harzianum LBM 096 presented radial mycelial growth inhibition higher than 50% and antagonism index between 3 and 4 against the phytopathogens assayed. Among the different substrate sources evaluated, rice husk and rice polishing were the most suitable combination for mass multiplication of T. harzianum LBM 096.

Keywords: Biological control agent; Soil; Phytopatogens fungi; Rice husk; Rice polishing.

---

 

INTRODUCTION

The genus Trichoderma comprises a great number of fungal strains that act as biological control agents (BCAs), which antagonistic properties are based on the activation of multiple mechanisms [1, 2, 3]. Antagonists of phytopathogenic fungi have been used to control plant diseases, and 90% of such applications were carried out with diferent strains of the genus Trichoderma [3]. These properties made Trichoderma a ubiquitous genus present in any habitat and with high population densities.

Trichoderma strains are always, or frequently associated with plant roots and root ecosystems [4]. Some authors have defined Trichoderma strains as plant symbiotic opportunistic avirulent organisms, able to colonize plant roots by mechanisms similar to those of mycorrhizal fungi and to produce compounds that stimulate growth and plant defense mechanisms [5].

It is suitable to know the Trichoderma genus when it is introduced as a biocontrol agent into the rhizosphere of a given ecosystem for both control eficiency and environ-mental conservation reasons [6]. Therefore, it should be considered morphological and molecular data from DNA sequencing to identify and characterize Trichoderma spp. [7]. One of the most reliable analyses for identifying a strain at the species level is the internal transcribed spacer (ITS) region [8].

Some of the phytopathogens that afect regional horti-culture and plantation crops of Misiones province species are Fusarium sp., Alternaria sp. and Botritis sp. Fusarium sp. is reported as a soil pathogen that affects yerba mate nurseries [9]. Alternaria sp. and Botritis sp. are responsible for diseases in ornamental fowers and citrus plants [10, 11].

One of the widely used approaches to improve the agriculture production is the application of chemical pesticides. However, the degradation in the environment of such compounds is very dificult and the concentration and/or accumulation of them in food chains lead to high toxicity levels in animals [12]. Nevertheless, intensive agriculture needs continuous research for the develop-ment of new fertilizers and plagues controllers that care about environmental pollution and human health hazards. Biological methods would be a preferable alternative for controlling regional plants diseases using endogenous and domestic microorganisms.

The potential of Trichoderma strains as control plant pathogens embodies an economically attractive choice [13, 14, and 15]. In recent years, the search for Trichoderma isola-tes with a high antagonistic potential has increased [5, 2]. The application of strains with biological control capacities can help to reduce the input of chemical pesticides in agriculture, where it is necessary to introduce high levels of spores to the feld. Therefore, agro industrial wastes can provide and economical and suitable source of substrates to produce significant amount of spores of Trichoderma [16, 17].

The primary aim of the present study was to isolate Trichoderma strains from soil samples of ecosystems without human impact in Misiones (Argentina). The native Trichoderma isolates were characterized by morphological observation and quick molecular identification. The strains were evaluated for their antagonist capacity against Fusa-rium sp., Alternaria spp. (strains 1 and 2), and Botrytis sp., which are phytopathogens that afect agriculture crops. Fi-nally, agricultural wastes were assessed for their suitability as substrates for Trichoderma mass multiplication pursuing an economically and efective production methodology.

MATERIALS AND METHODS

Plant pathogens

Fusarium sp., Alternaria spp. (strains 1 and 2) and Botrytis sp., isolated from Argentina, were kindly provided by the Culture Collection of the Buenos Aires University (BAfic). These phytopathogens are the main responsible for plant diseases.

Soil sampling and fungal isolation

Soil samples were collected from “Ñacanguazu” creek in Gobernador Roca (GPS coordinates 27º06’ S; 55º22’ W), “Teyú Cuaré” Provincial Park in San Ignacio (GPS coor-dinates 27º16’ S; 55º35’ W) and “Profundidad” Provincial Park in Candelaria (GPS coordinates 27º33’ S; 55º42’ W), all in Misiones, Argentina. The soil samples were collected at 15 cm of depth in an area of 1 m² with 5 repetitions. The temperature and humidity of each collected place were recorded. The samples were immediately transported to the laboratory for pH and water content determination. The samples were diluted in sterile distilled water (1:1000 and 1:10000) and cultured using potato dextrose agar (PDA 3.9%), pH 6.5. After 10 days of incubation at 27±1°C, single colonies with morphology characteristic of Trichoderma sp. were selected for sub-culture and for further morphological and molecular identification. All strains were stored at -80°C in their respective liquid media with 15% glycerol.

DNA extraction and quick molecular identification

Fungal genomic DNA was extracted following a mo-difed method described by Doyle [18]. Mycelia for DNA extraction were grown in liquid cultures at 27±1°C in malt extract broth (MEB) for 3-5 days in the dark. Mycelia was fltered and washed with 0.1 M Tris-HCl (pH 8) and 0.02 M EDTA (pH 8). DNA extraction was carried out with bufer solution (0.1 M Tris-HCl pH 8, 1.5 M NaCl, 0.05 M EDTA pH 8) at 60ºC, containing 0.1 mg/ml Proteinase K, 0.01 M β-mercaptoethanol and 2% SDS. DNA was purifed with chloroform: isoamilyc alcohol (24:1) and 3M potassium acetate and then was precipitated with isopropyl alcohol. Pure DNAs extracted from the isolates were amplifed at the ITS region and sequenced for phylogenetic analyses.

ITS1-5.8S-ITS2 region sequences of the ribosomal gene were used for fungi classification as described previously [19]. For the amplification, reaction primers ITS1 5’ TTCGTAGGTGAACCTGCGG and ITS4 5’ TCCTCCGCTTATTGATATGC [20] were used. The amplification reactions were prepared in a final volume of 20 µL containing 1X KCl bufer, 2.5 mM MgCl₂, 200 µM dNTPs for each 10 pmol primer [20], 0.5 U of Taq polymerase and template 5 ng/µl DNA. PCR amplification conditions were 94ºC for 40 s, 50ºC for 40 s and 72ºC for 40 s for 35 cycles, with 10 min extension at 72ºC used for the final cycle. Agarose gels at 1% and 2% were carried out to visualize genomic DNA and PCR products, respec-tively. The purification and sequencing procedures were performed by Macrogen Korea.

The ITS gene sequences of the isolated strains were compared with those deposited in the National Center for Biotechnology Information Database (NCBI, www.ncbi. nlm.nih.gov) with the special alignment search tool Tri-choKey 2.0 and TrichoBLAST 2.0 to confrm Trichoderma species [19] and with Database Fungal barcoding (www. fungalbarcoding.org/). The isolates had significant hits to the genus that owed the lowest e-value in the results of BLAST. Alignments of nucleotide sequences were carried out with the Clustal W software [21]. To allow an appropriate phylogenetic analyses, sequences of another strains of Trichoderma were included in the present study (accession numbers: JQ040311, EU280132, EU280136, EU280105, KP898755, FJ430784, JX125615, HQ596981, KF294838, KJ767092, KC478546, HQ637329, HQ260623, EU280095, DQ200259, HM461859, KC582841, FJ459964, JN943376, JN943375, JN943374, AY737767, FJ860752, AF275322, AY737762, HM142362, GU934533, JX069200, JX069201, EU280087, KC884785, KC561076, JX908732). The parsimony analyses were performed with Bootstrap methods [22] included 1000 replications. In the analyses, Hypomyces subiculosus (EU280093) were used as an out-group.

Fungal inhibition assays

Nine cm Petri plates containing potato dextrose agar (PDA) were inoculated with 7 mm mycelial discs of either Fusarium sp., Alternaria sp. or Botrytis sp., and Trichoderma isolates 10 mm away from the edge of the plate opposite to each other. Plates inoculated with the Trichoderma strains and pathogens strains alone served as control. Plates were incubated at 27±1°C for Alternaria sp. and Fusarium sp. and 14±1°C for Botrytis sp. Three replicate plates were done for each treatment. The radial growth was measured progressively. The eficacy of the antagonist in inhibiting the pathogen growth was evaluated quantitatively by the inhibition grade formula. The percen-tage of growth inhibition was calculated using the equation RI=100 x (R2 - R1)/R2 when the contact started, where RI was the percentage of reduction in mycelial growth, R1 was the averaged growth of pathogen in treated plates and R2 was the averaged growth of pathogen in control plates [23]. An efective antagonist strain is capable of inhibiting 50% or more the pathogen growth. The antagonism index was calculated afiter ten days of the starting day with Bell scale modified by Calistru [24, 25]: 4 corresponded to 100% Trichoderma sp. coverage on the phytopathogen and 0 corresponded to 100% phytopathogen coverage over Trichoderma strains. An index of 3 or 4 it is considered an efective antagonist strain.

Culture substrates of Trichoderma strains for mass production

The best sporulation condition of T. harzianum LBM 096 using agro industrial wastes as solid substrate for mi-crobial cultivation was assayed. Rice was used as control. The substrates consisted of sawdust, rice polishings, rice four and rice husk with diferent moisture content depending on the treatment (Table 1). As primary inoculum the strain was grown on 2 g/ml rice substrate. Fermentation assays were carried out without external nutrient addition. All substrates were autoclaved for 15 min at 121ºC, inoculated with 3x10⁸ spores and incubated at 27±1ºC in natural light for 15 days. Spores were removed by washing with distilled water containing 0.5% Tween 20 and were counted following the Neubauer method.

Table 1: Media formulations with different local agro industrial wastes.

Treatment	Substiate					Water
	Sawdust	Rice polishings	Rice four	Rice husk	Rice
1	40 g	-	-	-	-	20 mi
2	20 g	20 g	-	-	-	20 mi
3	20 g	-	20 g	-	-	20 mi
4	-	-	-	20 g	-	20 mi
5	-	10 g	-	10 g	-	20 mi
6	-	-	10 g	10 g	-	20 mi
7	-	-	-	-	40 g	20 mi

Statistical analysis

The data obtained in all experiments were subjected to analysis of variance (ANOVA) with Turkey’s test using the SPSS sofitware, version 22.0 (IBM Corp, Armonk, NY, USA), at a significance level of 5%.

RESULTS

Soil sampling and fungal isolation

Out of 20 colonies per plate obtained from soil samples, 15 fungal isolates were selected as probable Trichoderma strains (Table 2). Aerial mycelium of the colonies was initially thick and whitish. When the sporulation started, the colony turned green and the periphery of the colonies remained white. At a microscopical level, we identifed phialides with a fask-shaped formed at wide angles to the conidiophore, and with conidia clustered together at the end of each phialide.

Table 2: Locations and soil conditions of fungal ¡solates

Soil Sample	Location	Isolate	RH %	T°C	pH	WC %
1	Ñancanguazú stream	LBM 090	70	17.8	7.60	36.4
2	Ñancanguazú stream	LBM 091 LBM 092 LBM 093 LBM 094	70	17.1	7.28	44.6
3	TeyúCuaré	LBM 103	65	17.2	7.86	45.8
4	TeyúCuaré	LBM 104	66	16.5	7.56	37.8
5	Profundidad	LBM 095 LBM 096 LBM 097 LBM 098 LBM 099 LBM 100 LBM 101 LBM 102	55	15.0	7.60	36.9

Note: RH: relative humidity, WC: water content.

We were able to accurately classify at genus level the isolated Trichoderma strains by applying morphological criteria.

The ITS1-5.8S-ITS2 gene sequences of the 15 isolates were compared with those sequences deposited in the three database utilized, indicating that they had significant hits to the genera Trichoderma. Seven isolates were identified as Trichoderma harzianum (LBM094, accession number of NCBI: JX069200, LBM096, acces-sion number of NCBI: JX069196, LBM097, accession number of NCBI: JX069197, LBM100, accession num-ber of NCBI: JX069198, LBM101, accession number of NCBI: JX069199, LBM103, accession number of NCBI: JX069201, LBM104, accession number of NCBI: JX069195), six as Trichoderma koningiopsis (LBM090, accession number of NCBI: JX069205, LBM091, acces-sion number of NCBI: JX069206, LBM092, accession number of NCBI: JX069207, LBM098, accession num-ber of NCBI: JX069202, LBM099, accession number of NCBI: JX069203, LBM102, accession number of NCBI: JX069204), one as Trichoderma brevicompactum (LBM095, accession number of NCBI: JX069193), and one as Trichoderma pleuroticola (LBM093, accession number of NCBI: JX069194). All strains, in all database consulted, had 97% to 100% of similarity with the referen-ce sequence of each species.

A phylogenetic tree using the fifteen Trichoderma spp. isolated ITS sequences [19] was constructed based on parsimony analyses (Figure 1).

The phylogenetic analysis revealed close positioning of seven isolates of T. harzianum (LBM094, LBM096, LBM097, LBM100, LBM101, LBM103, LBM104) and T. pleuroticola LBM093 in a closely related group, in concordance with actual taxonomic classification of clade Harzianum, Pachybasium Section (accessible at http:// www.isth.info/biodiversity/index.php). The six isolates corresponding to T. koningiopsis (LBM090, LBM091, LBM092, LBM098, LBM099, LBM102) revealed close related positioning in the same group, in Trichoderma Sec-tion. T. koningiopsis LBM091 and LBM092 corresponded to the same strain because they were no genetic distance between them and were isolated from the same place (Ñancanguazú creek). Finally, T. brevicompactum LBM 095 showed high genetic distance to the other strains and belongs to Lutea clade, Lone Lineages Section (Figure 1).

Figure 1: Parsimony analysis based on ITS sequences from all isolates of Trichoderma. Group support with 1000 Bootstrap.

 

On dual confronted cultures, Trichoderma strains rea-ched Fusarium sp. and Alternaria sp. (strain 1) in 3 days, Alternaria sp. (strain 2) in 4 days and Botrytis sp. in 10 days (Table 3). The strains T.a koningiopsis LBM 090 and LBM 091, LBM 098, LBM 092, T. pleuroticola LBM 097, T. har-zianum LBM 096 and Trichoderma koningiopsis presented %RI higher than 50% indicating that strains are efective antagonists. Among the isolates, T. koningiopsis LBM 090 and T. koningiopsis LBM 098 showed the highest percentage of growth inhibition (60-70%) against Botrytis sp. (Table 3).

From all strains studied, inhibition by the Trichoderma strains in dual cultures did not show statistically significant diferences with Alternaria sp. (strain 1), Alternaria sp. (strain 2) and Fusarium sp. In contrast, Trichoderma strains showed significant diferences with Botrytis sp. Trichoder-ma koningiopsis LBM090 showed the best %RI in dual confronted assays towards the four phytophatogens strains studied (Table 3). Based on the result obtained with Bell scale modifed, all strains resulted efective antagonists with a value of 3 and 4 in this scale indicating 100% cove-rage of the pathogen colonies. Trichoderma koningiopsis LBM090, LBM091 and LBM098 presented a value of 4 to all strains of pathogens. These strains exerted antagonist and parasitism capacities against regional phytopathogens and would be potential biological controls.

Table 3: Mycelial growth inhibition percentage (%RI) of Trichoderma strains versus phytopathogenic fungal strains.

	Alternaría sp. (straín 1)	Alternaría sp. (straín 2)	Fusarium sp.	Botrytis sp.
	%RI on day 3	%RI on day 4	%RI on day 3	%RI on day 10
T. koningiopsis LBM 090	36.51 ± 5.50a	39.73 ± 5.48a	51.44 ± 1.87a	63.11 ± 3.98a
T. koningiopsis LBM 091	28.57 ± 4.76a	15.98 ± 3.16a	46.63 ± 5.46a	49.67 ± 1.65ab
T. koningiopsis LBM 092	28.57 ± 4.76a	28.77 ± 5.48a	46.63 ± 1.52a	45.19 ± 7.80ab
T. koningiopsis LBM 098	33.33 ± 9.52a	34.25 ± 7.25a	51.44 ± 5.72a	58.89 ± 5.47ab
T. koningiopsis LBM 099	25.40 ± 5.50a	30.60 ± 6.33a	41.38 ± 5.46a	43.08 ± 2.74ab
T. koningiopsis LBM 102	16.66 ± 3.37a	30.59 ± 4.18a	45.76 ± 1.52a	36.76 ± 3.16ab
T. harzianum LBM 094	17.86 ± 1.69a	23.29 ± 5.48a	39.63 ± 6.94a	nd
T. harzianum LBM 096	30.16 ± 7.27a	26.94 ± 8.37a	45.76 ± 6.06a	45.19 ± 2.41ab
T. harzianum LBM 097	30.16 ± 7.27a	32.74 ± 7.85a	42.26 ± 10.50a	45.19 ± 5.08ab
T. harzianum LBM 101	18.25 ± 3.64a	28.77 ± 5.48a	40.51 ± 1.52a	37.55 ± 1.12ab
T. harzianum LBM 100	20.63 ± 2.75a	24.20 ± 6.90a	40.07 ± 4.97a	32.02 ± 7.91b
T. harzianum LBM 103	25.40 ± 5.50a	23.30 ± 0.01a	43.57 ± 3.47a	42.55 ± 1.82ab
T. harzianum LBM 104	26.42 ± 3.55a	26.30 ± 1.51a	42.67 ± 4.74a	39.65 ± 3.21ab
T. brevicompactum LBM 095	29.36 ± 3.64a	25.11 ± 6.33a	37.88 ± 1.52a	39.92 ± 5.47ab
T. pleuroticola LBM 093	25.40 ± 2.75a	23.29 ± 7.75a	43.13 ± 1.52a	48.88 ± 7.80ab

Note: Means followed by the same letter in each column do not differ significantly by Tukey test at 5% probability. nd: not determined.

 

The suitable condition for mass multiplication of T. harzianum LBM096 was evaluated. Among the substrates evaluated, the mix of rice husk and rice polishing yielded the highest sporulation (1.96x10¹⁰ spores/g substrate) followed by rice husk and rice four (1.45x10¹⁰ spores/g substrate), sawdust and rice polishing (1.12x10¹⁰ spores/g substrate) and sawdust and rice flour (6.4x10⁹ spores/g substrate). Results indicated that the best spore production was found in substrates with rice four and rice polishing. Significantly lower spore concentration was recorded in 1, 3, 4 and control treatments (Figure 2).

Figure 2: Evaluation of substrates for mass production. Identical number means no statistically significant differences between these treatments (P > 0.05). 1: Sawdust; 2: Sawdust and Rice polishings; 3: Sawdust and Rice four; 4: Rice husk; 5: Rice polishings and Rice husk; 6: Rice four and Rice husk; 7: Rice.

DISCUSSION

The fifiteen Trichoderma strains were isolated from low human impacted ecosystems because the expected diversity, as it is documented by other authors [26, 27, 28].

The correct identification at species level is highly desirable because some of them can be possible risks to human health [29]. Systematic studies of microorganisms were based almost exclusively on morphological criteria (classical microbiological classification). Currently, the tools used in systematic studies have increased, and not only the morphological criteria, but also molecular criteria are considered. However, the number of tools used in systematic studies has increased. Nowadays, both morpho-logical and molecular criteria need to be taken into account [30, 31]. Since the primary aim of the present study was to isolate Trichoderma strains from soil samples from low human impacted ecosystems, in this work it was done a rough molecular identification of the Trichoderma strains using only ITS Barcodes. We considered the classical mi-crobiological classification by morphological criteria and molecular techniques by amplification of ITS1, 5.8S and ITS2 regions. The ITS1-5.8S-ITS2-28S regions can have nucleotide variations since their transcripts are excised from the final rRNA fragments. Therefore, the ITS sequen-ce includes both ITS1 and ITS2, which are separated by the conserved short 5.8S rRNA. They are usually used to infer phylogenetic relationships of closely related species as well as to assess the variability of a population, e.g. of geographically distant isolate (ecotypes) and recommended by Druzhinina et al. [19] as Hypocrea/Trichoderma barco-de. These regions are appropriate for detecting diferences between conspecific individuals and hence, are potentially useful markers to study the relationships of populations and closely related species in fungal, plant, and animal taxa due to their relatively rapid evolutionary rates [32, 33]. The ITS was chosen as the oficial barcode for fungi by a consortium of mycologists and it is among the markers with highest probability of correct identification for a very broad group of sampled fungi [34, 35]. Recently, there are many researches that used tef-1 and RPB2 as complemen-tary barcodes for Trichoderma species identifications [36].

We isolated 15 native strains of Trichoderma genus from Misiones, Argentina to study their antagonist capa-city. T. koningiopsis LBM 090 was the most promissory strain; however, T. koningiopsis LBM 090, LBM 091 and LBM 098 showed some interesting aspects as potential biological control agents. Two strains of T. koningiopsis (LBM090 and LB098) showed the best results in the antagonism tests. However, using qualitative analyses, all strains were capable to reduce and invade more than 75% of the phytopatogen fungi growth after ten days. These results indicate the potential of antagonistic strain to reduce diseases in feld conditions. Larralde-Corona et al. [37], selected new T. koningiopsis strains as biological control agents to sorghum phytopathogens. There are other reports showing the inhibitory efect of other Trichoderma species on the same phytopathogens used in this work. T. harzianum on Alternaria alternata, for tobacco [1]; T. harzianum on Fusarim oxysporum with similar %RI [38]; T. harzianum on Fusarim solani [39]; T. hamatum and T. atroviride for Pinus radiata [40], Trichoderma asperellum strain CCTCC-RW0014 showed to have good biocontrol potential with disease reduction of 71.67% against Fusarium oxysporum f. sp. cucumerinum [41]. Pugliese et al. [42] selected antagonistic fungi from compost as a promising strategy for the development of new biological control agents against soil-borne pathogens.

One important aspect to biotechnological prospection is a high production of spores in an adequate substrate. Forestry is one of the principal activities of Misiones state and sawdust reuse is a government priority. Here, we demonstrated the convenience of sawdust as a substrate for spores production at level superior of 10⁸, in concordance with systems proposed for other substrates [43, 44, 16]. Interestingly, our system with sawdust produced more spores than the sawdust system proposed by Kumar and Palakshappa [45].

Conclusions

In conclusion, 15 strains were isolated in natural soils of Misiones province. Several candidate strains were identifed to act against Alternaria sp., Fusarium sp. and Botrytis sp. The formulation of rice husk and rice polishing resulted as the best suitable combination of substrates to increase the mass production. Our results are the starting point for future studies on the utilization of native strains with antagonist properties in our region. It is still needed to study deeply the biological control mechanisms in feld experiments with these strains.

Acknowledgements

The authors thank the Biofábrica de Misiones SA (BIOMISA). Part of the experimental work was funded by BIOMISA. JGB had a fellowship for postgraduate studies of CEDIT, Misiones, Argentina. MAS, MLC and ACL has a fellowship of CONICET.

REFERENCES

1.    Gveroska, B; Ziberoski, J. Trichoderma harzianum as a biocontrol agent against Alternaria alternata on tobac-co. Appl Innov Technol. 7: p. 67-76. 2012.         [ Links ]

2.    de Lima, FB; Félix, C; Osório, N; Alves, A; Vitorino, R Domingues P, da Silva Ribeiro, RT; Esteves, AC. Trichoderma harzianum T1A constitutively secretes proteins involved in the biological control of Guignardia citricarpa. Biol Control. 106: p. 99-109. 2017.         [ Links ]

3.    Pandya, JR; Sabalpara, AN; Chawda, SK. Trichoderma: a particular weapon for biological control of phytopathogens. J. Agricult Technol. 7: p. 1187-1191. 2011.         [ Links ]

4.    Harman, GE. Overview of Mechanisms and Uses of Trichoderma spp. Phytopathology. 96: p. 190-194. 2006.         [ Links ]

5.    Martínez-Medina, A; Alguacil, MDM; Pascual, JA; Van Wees, SC. Phytohormone profles induced by Trichoderma isola-tes correspond with their biocontrol and plant growth-promoting activity on melon plants. J Chem Ecol. 40: p. 804-815. 2014.         [ Links ]

6.    Galarza, L; Akagi, Y; Takao, K; Kim, CS; Maekawa, N; Itai, A; Peralta, E; Santos, E; Goh, CH; Vallejos, DFV; Nicotra, AB; Mathesius, U. The impact of beneficial plant-associated microbes on plant phenotypic plasticity. J Chem Ecol. 39: p. 826–839. 2013.         [ Links ]

7.    Samuels, GJ. Trichoderma: systematics, the sexual state, and ecology. Phytopathology 96: p. 195-206. 2006.         [ Links ]

8.    Kullnig-Gradinger, CM; Szakacs, G; Kubicek, CP. Phylogeny and evolution of the genus Trichoderma: a multigene ap-proach. Mycol Res. 106: p. 757–767. 2002.         [ Links ]

9.    Pérez, ML; Collavino, MM; Sansberro, PA; Mroginski, LA; Galdeano,

10 Marcela A. Sadañoski et al.: Capacidades antagónicas de Trichoderma spp. y su multiplicación masiva E. Diversity of endophytic fungal and bacterial communities in Ilex paraguariensis grown under feld condi-tions. World J Microbiol Biotechnol. 32: p. 1-15. 2016.

10.    Peres, NAR; Agostini, JP; Timmer, LW. Outbreaks of Alterna-ria brown spot of citrus in Brazil and Argentina. Plant Dis. 87: p. 750-750. 2003.         [ Links ]

11.    Lopez, AAS; Rennis, L; Cabrera, MG; Castillo, AE. Determinación de hongos patógenos en cultivos ornamentales y su control con soluciones de propóleos. Agrotecnia. (22): p. 13-17. 2016.         [ Links ]

12.    Baker, RR; Dunn, PE. New directions in biological control. Alternatives for suppressing agricultural pests and di-seases. Wiley-Liss Inc. 1990.         [ Links ]

13.    Monte, E. Understanding Trichoderma: between biotechnology and microbial ecology. Int Microbiol. 4(1): p. 1-4. 2001.

14.    Harman, GE; Howell, CR; Viterbo, A; Chet, I; Lorito, M. Tricho-derma species opportunistic, avirulent plant sym-bionts. Nat Rev Microbiol. 2: p. 43-56. 2004.

15.    Lorito, M; Woo, SL; Harman, GE; Monte, E. Translational research on Trichoderma: from ‘omics to the feld. Annu Rev Phytopathol. 48: p. 395-417. 2010.

16.    Rini CR; Sulochana, KK. Substrate evaluation for multipli-cation of Trichoderma spp. J Trop Agri. 45: p. 58-60. 2007.

17.    Ahmed, S; Mustafa, G; Arshad, M; Rajoka, MI. Fungal biomass protein production from Trichoderma harzianum using rice polishing. Biomed Res Int. 2017.

18.    Doyle, JJ. A rapid DNA isolation procedure for small quantities of fresh leaf tissue. Phytochem bull. 19: p. 11-15. 1987.

19.    Druzhinina, IS; Kopchinskiy, AG; Komoń, M; Bissett, J; Szakacs, G; Kubicek, CP. An oligonucleotide barcode for species identification in Trichoderma and Hypocrea. Fungal Genet Biol. 42: p. 813-828. 2005.

20.    White, TJ; Bruns, T; Lee, SJWT; Taylor, JW. Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. PCR protocols: a guide to methods and applications. 18: p. 315-322. 1990.

21.    Goloboff, PA. Analyzing large data sets in reasonable times: solutions for composite optima. Cladistics. 15: p. 415-428. 1999.

22.    Felsenstein, J. Confidence limits on phylogenies: an approach using the bootstrap. Evolution. p. 783-791.1985.

23.    Desai, S; Reddy, MS; Kloepper, JW. Comprehensive testing of biocontrol agents. Biol Control Crop Dis. p. 387-420. 2002.

24.    Bell, DK; Wells, HD; Markham, CR. In vitro antagonism of Trichoderma species against six fungal plant patho-gens. Phytopathology. 72: p. 379-382.1982.

25.   Calistru, C; McLean, M; Berjak, P. In vitro studies on the po-tential for biological control of Aspergillus favus and Fusarium moniliforme by Trichoderma species. Myco-pathologia. 137: p. 115-124. 1997.

26.    Zachow, C; Berg, C; Müller, H; Meincke, R; Komon-Zelazowska, M; Druzhinina, IS; Kubicek, CP; Berg, G. Fungal diversity in the rhizosphere of endemic plant species of Tenerife (Canary Islands): relationship to vegetation zones and environmental factors. ISME J. 3: p. 79-92. 2009.

27.    Hoyos-Carvajal, L; Orduz, S; Bissett, J. Genetic and metabo-lic biodiversity of Trichoderma from Colombia and adjacent neotropic regions. Fungal Genet Biol. 46: p. 615-631. 2009.

28.    Adetutu, EM; Thorpe, K; Bourne, S; Cao, X; Shahsavari, E; Kirby, G; Ball, AS. Phylogenetic diversity of fungal communities in areas accessible and not accessible to tourists in Naracoorte Caves. Mycologia. 103: p. 959-968. 2011.

29.    Fontenelle, ADB; Guzzo, SD; Lucon, CMM; Harakava, R. Growth promotion and induction of resistance in tomato plant against Xanthomonas euvesicatoria and Alternaria solani by Trichoderma spp. Crop Prot. 30: p. 1492-1500. 2011

30.    Pérez Valencia, LI; Santerre, A; Villallobos Arámbula, AR; Gal-ván Corona, A; Torres-Torres, MG; Rodríguez Contreras, A; Guz-mán Dávalos, L. Extracción de DNA y amplificación de secuencias del ITS del DNAr de Ganoderma (Fungi, Basidiomycetes) para su uso en el análisis flogenético. CUCBA. 8. 2005.

31.    Castrillo, ML; Fonseca, MI; Bich, GA; Jerke, G; Horianski, MA; Zapata, PD. Taxonomy and phylogenetic analysis of Aspergillus section nigri isolated from yerba mate in Misiones (Argentina). BAG J Basic Appl Genet. 23: p. 19-27. 2012.

32.    Weekers, PH; De Jonckheere, JF; Dumont, HJ. Phylogenetic relationships inferred from ribosomal ITS sequences and biogeographic patterns in representatives of the genus Calopteryx (Insecta: Odonata) of the West Me-diterranean and adjacent West European zone. Mol Phylogenet Evol. 20: p. 89-99. 2001.

33.    Oliverio, M; Cervelli, M; Mariottini, P. ITS2 rRNA evolution and its congruence with the phylogeny of muricid neogastropods (Caenogastropoda, Muricoidea). Mol Phylogenet Evol. 25: p. 63-69. 2002.

34.    Kelly, LJ; Hollingsworth, PM; Coppins, BJ; Ellis, CJ; Harrold, P; Tosh, J; Yahr, R. DNA barcoding of lichenized fungi de-monstrates high identification success in a floristic context. New Phytologist. 191(1): p. 288-300. 2011.

35.    Schoch, CL; Seifert, KA; Huhndorf, S; Robert, V; Spouge, JL; Le-vesque, CA; Chen, W. Nuclear ribosomal internal transcri-bed spacer (ITS) region as a universal DNA barcode marker for Fungi. Proc. Natl. Acad. Sci. U.S.A. 109: p. 6241-6246. 2012.

36.    Raja, HA; Miller, AN; Pearce, CJ; Oberlies, NH. Fungal identif-cation using molecular tools: a primer for the natural products research community. J. Nat Prod. 80(3): p. 756-770. 2017.

37.   Larralde-Corona, CP; Santiago-Mena, MR; Sifuentes-Rincon, AM; Rodríguez-Luna, IC; Rodriguez-Perez, MA; Shirai, K; Narvaez-Za-pata, JA. Biocontrol potential and polyphasic characterization of novel native Trichoderma strains against Macrophomina phaseolina isolated from sorghum and common bean. Appl Microbiol Biotechnol. 80: p. 167-177. 2008.

38.    Fernández Barbosa, RJ; Suárez Meza, CL. Antagonismo in vi-tro de Trichoderma harzianum Rifai sobre Fusarium oxysporum Schlecht f. Sp passiflorae en maracuyá (Passifora edulis Sims var. Flavicarpa) del municipio zona bananera colombiana. Rev. Facultad Nacional de Agronomía, Medellín. 62: p. 4743-4748. 2009.

39.    Cubillos Hinojosa, JG; Páez Redondo, A; Mejía Doria, L. Evaluación de la capacidad biocontroladora de Trichoderma harzianum Rifai contra Fusarium solani (Mart.) Sacc. asociado al complejo Secadera en Maracuyá, bajo condiciones de invernadero. Rev. Facultad Nacional de Agronomía, Medellín. 64: p. 5821-5830. 2011.

40.    Hohmann, P; Jones, EE; Hill, RA; Stewart, A. Understanding Trichoderma in the root system of Pinus radiata: asso-ciations between rhizosphere colonisation and growth promotion for commercially grown seedlings. Fungal Biol. 115: p. 759-767. 2011.

41.    Saravana Kumar, K; Yu, C; Dou, K; Wang, M; Li, Y; Chen, J. Syner-gistic efect of Trichoderma-derived antifungal meta-bolites and cell wall degrading enzymes on enhanced biocontrol of Fusarium oxysporum f. sp. cucumeri-num. Biol Control. 94: p. 37-46. 2016.

42.    Pugliese, M, Gullino, ML; Garibaldi, A. Eficacy of microor-ganisms selected from compost to control soil-borne pathogens. Commun Agric Appl Biol Sci. 75: p. 665-669. 2009.

43.    Ramos, A; Yabid, E; Zapata Navarro, RI; Oviedo Zumaqué, LE; Vio-leth, B; Luis, J. Evaluation of substrates and fermentation solid process for spores production of Trichoderma sp. Rev. Col. Biotecnol. 10: p. 23-34. 2008.

44.    Chaudhari, PJ; Shrivastava, P; Khadse, AC. Substrate evalua-tion for mass cultivation of Trichoderma viride. Asiat J Biotechnol Resour. 4: p. 441-446. 2011.

45.    Kumar, TP; Palakshappa, MG. Evaluation of suitable substra-tes for on farm production of antagonist Trichoderma harzianum. Karnataka J Agric Sci. 22: p. 115-117. 2009.

Recibido: 05/12/17. Aprobado: 24/04/18.